Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
A human liver cell has a different size and shape from a human muscle cell. What is the best explanation for these differences?
A. The cells perform different functions.
OB. One of the cells is used to reproduce more cells while the other is not.
OC. One type of cell develops into the other type of cell.
OD. One of the cells must have come from another species.
Answer:
A
Explanation:
A human liver cell would have a different size and shape from a human muscle cell because they perform different functions in the body.
The shape a cell would assume and its size depends on the function the cell performs. The functions of the liver in the body of humans differ greatly from the functions of muscles. While the former helps in detoxification, deamination, digestion, etc., the latter helps in support, movement, etc.
The correct option is A.
A human liver cell has a different size and shape from a human muscle cell because the cells perform different functions.
CELL:
Cell is the basic and fundamental unit of life. It is the simplest level of organization of an organism. Cells contain organelles that help them perform specific functions. Organs are made up of numerous cells. Similar cells perform similar functions while dissimilar cells perform dissimilar functions. Therefore, a human liver cell has a different size and shape from a human muscle cell because the cells perform different functions.Learn more at: https://brainly.com/question/22663686?referrer=searchResults
Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore
Answer:
Decomposer
Explanation:
Decomposers eat dead organsims carnivores rarely
Answer:
C. Decomposer
Explanation:
A.P.E.X
4. Which is an example of a fungus?
O blue-green algae
slime mold
O bread mold
O brown algae
Answer:
Bread mold is an example of a fungus.
hope it helps!
Which of the following solutions would have solute concentration that is lower than the concentration found inside the cell
Answer:
hypotonic solution
A hypotonic solution has a lower solute concentration than inside the cell (the prefix hypo is Latin for under or below). The difference in concentration between the compartments causes water to enter the cell.
Thank you and please rate me as brainliest as it will help me to level up
Answer:
A. Hypotonic Solution
What is the definition of cell
Answer:
Small and sparsely furnished room, especially in a prison or convent.
"the detainees are together in cells with capacity for four or five people"
Cell of a honeycomb.
Explanation:
I hope to help you
I could really use some help on this question l, please help!?! Thank you ❤️ much love stay safe 2020
Answer: its B and D
Explanation:
PLEASE help its a question about rocks I'm tryna score a 80
Answer: The answer is C
Explanation:
lavas cool quickly at the earth's surface and are characterized by fine-grained texture, in which the crystals are too small to be seen by the unaided eye. Very quickly cooled lavas, typically those quenched in water, will have a glassy texture. They cool too quickly to form crystals.
Which of the following IS NOT a part of the cell theory? *
All organisms are made of one or more cells
All cells contain nuclei and membrane bound organelles
Cells arise from pre-existing cells
Cells are the basic units of structure and function
Answer:
all cells contain nuclei.
Explanation:
prokaryotes dont have a nuclei
1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False
Answer:
False.
Explanation:
Peer review provide others scientist in the field to assess a scientist's investigations and results.
Peer Review:
It is the reviewing or evolution of the work by many professionals and experts in the field.
For example- A scienfic manuscript is send to the many scientist for evolution before publication.
This peer review is unbiased because the reviewer does not know the name or other information about writter.
To know more about Peer Review:
https://brainly.com/question/10853815
describe and explain how the rate of photosynthesis is affected by light intensity
Hemoglobin is:
1) hormone;
2) Enzyme
3) protein;
4) Amino acid
HELPPP PLEASE!!!!
Answer:
The oxygen- carrying pigment and predominant protein in the RBC.
plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion
A student observes that a plant has droopy leaves and stems and infers that the rate of photosynthesis has slowed in the plant. Which statement provides evidence to support the student’s inference?
Answer:
A. The water pressure in the plant's vacuole is low, and without water, the chloroplasts cannot convert carbon dioxide to glucose during photosynthesis.
Explanation:
Photosynthesis occurs on chloroplasts which are located on the surface of leaves. Photosynthesis is the conversion of carbon dioxide, water, and light energy to produce glucose and oxygen for plants.
The vacuoles inside the plant's cell contain stored food and absorb water through osmosis. Water in the vacuole has more solutes than water outside the vacuole. This causes the Turgor Pressure which the vacuole impacts on the plants. If the reverse becomes the case, water is lost from the vacuole causing it to shrink.
Flaccidity of the vacuole and the cell wall will cause the chloroplasts where photosynthesis occurs to shrink.
Three samples of cells from three different patients were unlabelled. One sample was from an 85-year-old man, one was from a 5-year-old boy, and one was from a person with skin cancer. How could you determine to which patient they belonged?
The 85 year old man will have shorter telomeres.
The 5 year old will have long telomeres.
The person with skin cancer will have an abnormal karyotype and abnormal nucleus shape and size during interphase.
Genetic engineering involves _______ to achieve desired results. a. enzyme production b. modifying products and processes c. changing one organism into another d. introducing traits into organisms Please select the best answer from the choices provided A B C D
Answer:
D
Explanation:
the answer is d bruv like fr
Answer:
D
Explanation:
DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD
Describe how the circulatory system allows the endocrine system to do its job?
Answer:
The circulatory system is the transport system for endocrine info. The endocrine chemicals and hormones must circulate through the body via blood vessels.
Which is an example of the use of plants in human societs?
Answer:
|
v
Explanation:
photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.
What are two ways in which cells use the energy temporarily stored in ATP?
Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways
The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.
What is Active transport?
Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.
ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.
Learn more about ATP here:
https://brainly.com/question/14637256
#SPJ2
Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another
answer: yes
exanation:
Which of these are true of physical therapists? Check all of the boxes that apply.
All physical therapists can diagnose.
Physical therapists strengthen muscle and improve balance.
Physical therapists do not prescribe medication.
Physical therapists are considered doctors.
Physical therapists are commonly called physiatrists.
Which describes something that occurs during translation?
Answer: In translation process, the messenger RNA (mRNA) template is used to create amino acid chain by which a protein is formed. Translation is the process of synthesis of proteins from amino acids which the help of mRNA
Answer:
c
Explanation:
What three things regarding cell organelles are different between plant and animal cells?
Answer:
Plant cells have a cell wall, but animals cells do not. ...
Plant cells have chloroplasts, but animal cells do not. ...
Plant cells usually have one or more large vacuole(s), while animal cells have smaller vacuoles, if any are present
If two different species belong to the same family, then they also belong to the same _______. *
Kingdom
Class
Order
All of the above are correct
Answer:
All of the above
Explanation:
The order is Domain, Kingdom, Phylum, Class, Order, Family, Genus, Species.
If it is a smaller one it is always in the ones above it.
Cellular respiration is a process in which animal cells use ____ taken in from the atmosphere.
1) carbon dioxide
2) hydrogen
3) oxygen
Answer:
How does cellular respiration work in animals?
When an animal breathes, it takes in oxygen gas and releases carbon dioxide gas into the atmosphere. This carbon dioxide is a waste product produced by the animal's cells during cellular respiration. Cellular respiration occurs in the individual cells. Digested foods have chemical energy stored in them.
Explanation:
what dose cloraplast do
Answer:
Chloroplasts are a plant cell organelles and help. plants capture the energy of the sun.
Explanation:
they convert light energy to the sun relatively stable chemical energy via the photosynthetic process. By doing so, they sustain life on Earth
Which is an example of active transport?
a
Cells move sugar into their cells with energy
Water moves from where there is more water to where there is less
b
с
Salt moves from a 15% solution to a 2% solution
d
Dye moves from where it is dropped throughout an entire glass of water
Answer:
с ) Salt moves from a 15% solution to a 2% solution
Explanation:
In active transport, the particles move across a cell membrane from a lower concentration to a higher concentration. Active transport is the energy-requiring process of pumping molecules and ions across membranes "uphill" - against a concentration gradient.Aug 14, 2020
what is a cell membrane?
Answer:
The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.
Explanation:
Answer:
Short. The semipermeable membrane surrounding the cytoplasm of a cell.
Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.
Explanation:
Summarize the possible applications of gene knockout GMOs.
Answer:
This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.
Explanation:
This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.
I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)
In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.
Answer:
Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.
I tried my hardest and this is what I put on MY test so good luck
The movement of water in or out of the cell membrane without the use of ATP.
Diffusion
Facilitated diffusion
Osmosis
Excoytosis