What is 5 superscript 6 written in expanded form?

Answers

Answer 1
Answer: 5 times 5 times 5 times 5 times 5 times 5

Related Questions

Is the graph below proportional? Explain.
500
400
300
Total cost ($)
200
100
0 2 4 6 8 10
Time (h)

Answers

Answer:

50/1

Step-by-step explanation:

x=1,2,3

y=50,100,150

y/x=50/1

What’s 9 times 9

Just gave you 100 for free your welcome

Answers

Answer:

81!    THANK YOU<3333333333333

Answer: 81

Step-by-step explanation: 9 x 9 = 81 Obviously

- Save & Exit Certify
2/15
Correct
Question 4 of 15, Step 1 of 1
A rock is thrown upward with a velocity of 25 meters per second from the top of a 34 meter high cliff, and it misses the cliff on the way back down. When will the rock
be 8 meters from ground level? Round your answer to two decimal places.
Gravity Formula

Answers

Answer:

Do you have a picture because i work better with pictures

Step-by-step explanation:

Megan's room was remodeled. The new area of the room is 175% of the previous area. Only the length of the room changed. The width of the original room is 4m and the length of the original room is 4m. If the new room adds X to the length, what is the new expression for the new area? How many square meters has Megan's room increased? Explain how you solved the new area.

Answers

Answer:

new area = 7m (length) x 4m (width) = 28; an increase of 12 sq meters

Step-by-step explanation:

Original area must have been 16 because both the length and width were 6 meters.

175% of 16 is 12, meaning the length must be increased from 4 to 7 to get 28 when multiplied by a width of 4m

Pip can type 90 words a minute.
How many words can be typed in 10.5 minutes?

Answers

Answer:

the answer is 945

Step-by-step explanation:

simple math 90 x 10 = 900

.5 = 45

900 + 50 = 945

Answer:

945 minutes

Step-by-step explanation:

just multiply 90 by 10.5 buddy

-25+t/z greater these or =to 50

Answers

Answer:

=to 50

Step-by-step explanation:

PLEASE HELP!!!

John and Chuck are building a new house. When​ finished, the house will cost $190,750. The price of the house is 9% higher than the price when the original plans were made. What was the price of the house when the original plans were​ made?

Answers

Answer:

190,750 decreased by 9% is 173,582.5

Step-by-step explanation:

help? I know what i’m doing somewhat but i really just didn’t wanna pay attention in class the day this was taught

Answers

To solve the equation for x, first divide both sides of the equation by 4 to get [tex]e^{2.7x}=\frac{33}{4}[/tex]. Then, take the natural logarithm of both sides (base e) to get [tex]\ln e^{2.7x} = \ln (33/4)[/tex]. The left hand side of this equation if equal to 2.7x, so we get [tex]2.7x = \ln(33/4)[/tex]. The final step is to divide both sides of the equation by 2.7, to get that [tex]x =\frac{ \ln (33/4)}{2.7}[/tex]. This is approximately equal to 0.782.

Answer:

ily

Step-by-step explanation:

Lae bought grapes for $1.50 per pound. A 2-column table has 4 rows. Column 1 is labeled Pounds x with entries 1, 2, 3, 4. Column 2 is labeled Dollars y with entries 1.50, 3.00, 4.50, 6.00. Create a graph of the relationship between the two quantities. Complete the statements. Use the numbers in the table to create . are graphed on the x-axis. are graphed on the y-axis. Plot the on the graph. Draw a that starts at the origin and connects all the points.

Answers

The graph of dollar and pound table of Lae is graphed below in which pounds are graphed on the x-axis and dollars are graphed on the y-axis.

How to plot a graph from table?

To plot a graph from a table, make the ordered pair of values of coulom 1 and 2 of the table. Plot a line or curve with these ordered pair on the graph.

Lae bought grapes for $1.50 per pound. A 2-column table has 4 rows.

Column 1 is labeled Pounds x with entries    1,        2,        3,        4. Column 2 is labeled Dollars y with entries 1.50,  3.00,   4.50,   6.00.

The created graph of the relationship between the two quantities is attached below. Now lets complete the statements.

Use the numbers in the table to create ordered pair. Pounds are graphed on the x-axis. Dollars are graphed on the y-axis. Plot the ordered pair on the graph. Draw a straight line that starts at the origin and connects all the points.

Hence, the graph of dollar and pound table of Lae is graphed below in which pounds are graphed on the x-axis and dollars are graphed on the y-axis.

Learn more about plot a graph here;

https://brainly.com/question/26403321

Answer:

1. ordered pairs
2. pounds
3. dollars
4. ordered pairs
5. straight line

I apologize if im late!

Appliances at Discount City Store are on sale for 55% off of the original price. If the original price of a washing machine is $500, what does it cost after being reduced by 55% (before tax)?

Answers

Answer:

it will cost $255.

Step-by-step explanation:

225.

a product that normally costs $500 with a 55 percent discount will cost you $225.00, and you saved $275.00. You can also calculate how much you save by simply moving the period in 55.00 percent two spaces to the left, and then multiply the result by $500 as follows: $500 x . 55 = $275.00 savings.

The side length of an equilateral triangle is 4X +2 which expression represents the perimeter of the triangle

Answers

Answer:

12x + 6

Step-by-step explanation:

perimeter equals the sum of all sides

if each side is 4x+2 then 3(4x+2) = 12x+6

A bus driver drives 147 miles on her route each day. She drove the bus 23 days last month. How many miles did the bus driver drive the bus last month?



A: 3,381


B: 3,161


C: 2,381


D: 2,161

Answers

Answer:

Step-by-step explanation:

147 x 23 = 3381

=>

Answer:

B: 3381

Step-by-step explanation:

147 X 23 = 3,381. if she drove 147 miles for 23 days that's 3381 miles in one month

hello, can you please help? please show work. thank you!
-2x*(10x – 9x² - 7x + 4)​

Answers

Answer:

[tex]18x^{3}[/tex] -  [tex]6x^{2}[/tex] - 8x

Step-by-step explanation:

-2x(10x - [tex]9x^{2}[/tex] - 7x + 4)

-2x(3x - [tex]9x^{2}[/tex] + 4) Combine liked terms

-2x(-[tex]9x^{2}[/tex] +3x +4) Rearrange terms

[tex]18x^{3}[/tex] - [tex]6x^{2}[/tex] - 8x Distribute

[tex]18x^{3}[/tex] - [tex]6x^{2}[/tex] - 8x

easy question if your having big problem

Answers

Answer:

whats the problem

Step-by-step explanation:

Answer:

yup

Step-by-step explanation:

generate a continuous and differentiable function f(x) with the following properties: f(x) is decreasing at x=−6 f(x) has a local minimum at x=−3 f(x) has a local maximum at x=3

Answers

Answer:

HURRYYYY PLEASE HELP ME T-T

Step-by-step explanation:

https://brainly.com/question/19692618

Determine whether the mapping diagram shown below represents a
function
27 points

Answers

Answer:

Not a Function

Step-by-step explanation:

Each y-value has 2 x-values. It is supposed to only have one. hope this helped you!! Give brainliest

КУ Meccahi Grant Question #21 The perimeter of a rectangle is given by the algebraic Part A. expression 2x2 + 4x + 4. The width of this rectangle Create an algebraic expression in terms of x to 2 is given by the algebraic expression x? – 4. represent the length of the rectangle. The perimeter of a rectangle is given by the algebraic expression 2x2 + 4x +4. The width of this rectangle is given by the algebraic expression x2 - 4. Part A Create an algebraic expression in terms of x to represent the length of the rectangle. Part B If x = 3, what is the area of this rectangle in squa units? Remember to include units.​

Answers

Answer: The question requires an understanding of how to compose and decompose multi digit numbers. The expanded form 70,000 + 4,000 + 70 + 2 corresponds to the number 74,072, which is the population of Davidson County.

(sorry if i'm wrong)

:(

Is this correct??? Someone please help

Answers

Answer:

the line is inconsistent:)

Step-by-step explanation:

Yes it’s correct it’s inconsistent

Item 2

Find the area of the trapezoid.


b1=4,b2=8,h=2


ASAP TIMED WILL GIVE 35 POINTS>

Answers

Answer:

12 units squared.

Step-by-step explanation:

The formula for the area of a trapezoid is 1/2(base1+base2)*height.  First, add the two bases together.  4+8=12.  Then multiply that number by both 1/2 and the height, 2.  1/2*2*12 equals 12 units squared.

help please !!!! my brain hurts

Answers

Answer:

the answer id d.

Step-by-step explanation:

What is the z-statistic for the sample? Round the answer to the nearest hundredth. z =

Answers

Answer:

What is the z-statistic for the sample? Round the answer to the nearest hundredth.

z =  

2.07

Step-by-step explanation:

on edge :)

Answer:

2.07

Step-by-step explanation:

Niall bought 234 inches of nylon cord for rock climbing. There are 36 inches in 1 yard. How many yards of cord did Niall buy?

Answers

Answer:

6.5 yards of cord were bought

Step-by-step explanation:

234/36=6.5

9 out of 36 students wear glasses what percent of students wear glasses

Answers

Answer:

25%

Step-by-step explanation:

9 out of 36 is equal to 9/36, which equals 1/4.

1/4 is a quarter of a whole. a quarter is 25%

25%

9/36 = 1/4 = 0.25 = 25%

Solve for x enter the solution from least to greatest x2 - 11x + 18 =0

Answers

Answer:

x = 2 , 9

Step-by-step explanation:

[tex] {x}^{2} - 11x + 18 = 0[/tex]

[tex] = > {x}^{2} - 9x - 2x + 18 = 0[/tex]

[tex] = > x(x - 9) - 2(x - 9) = 0[/tex]

[tex] = > (x - 9)(x - 2) = 0[/tex]

Here x will have 2 solutions.

1) [tex]x - 9 = 0[/tex]

[tex] = > x = 9[/tex]

2)[tex]x - 2 = 0[/tex]

[tex] = > x = 2[/tex]

Hence the 2 solutions of x are +2 & +9

McDonalds sold 7 boxes of chicken nuggets for $25.90 Burger King sold 3 boxes of chicken fingers for $11.07. Which food item has a higher unit price? (1 Point McDonalds O Burger King.

Answers

Answer:

burger king

Step-by-step explanation:

math

Which two expressions are equivalent?
A 4(x + 5) and 4x + 9 C 4(x + 5) and 4x + 20
B 4(x + 5) and 4x + 5 D 4(x + 5) and 4 + x + 4 + 5

Answers

the answer is c bc when you multiple they equal

A sports equipment store rents road bikes for $23 an hour.
Over the summer, these bikes were rented for a total of
1,080 hours. How much money did the store make renting bikes?

Answers

Answer:

$24,840

Step-by-step explanation:

Please mark brainliest.

Lauren broght cupcakes for class of 24 students including herself. Each person received 1 cupcakes. Cupcakes come in pack of 7

Answers

Answer:

4 Packs

Step-by-step explanation: 24 put into groups of 7: there will be 3 full groups (three groups of seven) and one group will have only three in it. Therefore, 4 packs will be emptied. Hope this helps you !

Is a²b the same thing as ba² ?

Please explain. Thanks so much!

Answers

a²b is the same thing as ba²

b and a are two separate variables lets pretend a is 2 and b is 3

2² * 3 = 4 * 3 = 12

3 * 2² = 3 * 4 = 12

this is the commutative property of multiplication

An expression is defined as a set of numbers, variables, and mathematical operations. The two of the given expressions a²b and ba² are the same.

What is an Expression?

In mathematics, an expression is defined as a set of numbers, variables, and mathematical operations formed according to rules dependent on the context.

The two of the given expressions a²b and ba² are the same because if the two of the expressions are expanded then the value of the two expressions will be equal to each other.

Therefore, the two expressions are expanded as shown below,

a²b = a × a × b

ba² = b × a × a

Therefore, the two of the given expressions a²b and ba² are the same.

Learn more about Expression here:

https://brainly.com/question/13947055

#SPJ2

A classroom is painting the classrooms. Each classroom takes 1/3 of a gallon of
paint. If the school buys 6 gallons of paint, how many classrooms can they paint?
Plz help

Answers

Answer: try 18

Step-by-step explanation:

Other Questions
WILL MARK BRAINLIEST IF CORRECT PLEASE HELP!!Which graph represents this system?y = one-half x + 3. y = three-halves x minus 1A. On a coordinate plane, a line goes through (0, 3) and (4, 5) and another goes through (0, negative 1) and (2, 2).B. On a coordinate plane, a line goes through (0, 3) and (1, negative 3) and another goes through (0, negative 1) and (3, 1).C. On a coordinate plane, a line goes through (negative 1, negative 2) and (1, 4) and another goes through (0, 1.5) and (1.5, 0).D. On a coordinate plane, a line goes through (negative 3, negative 3) and (0, 3) and another goes through (0, negative 1) and (3, 1). Louisa spent 5/8 of an hour on math homework, 1/6 of an hour on science homework, and 7/12 of an hour on English homework. How much time total did she spend on homework? Pls help Thx I neeed help pleaseeee GUse the graph to answer the question.y6R543-21O3What are the coordinates of point R on the graph? Choose numbers to move to the lines to answer the question,56012 I need answer as quick 0.45 g of hydrated sodium carbonate crystals were heated until 3.87 of anhydrous power remained.How many moles of water are there in one mole of hydrated salt? Will mark as brainliest!!!!!!!!!! X3.1.PS-7QuestionA local little league has a total of 60 players, of whom 40% are right-handed. How manyright-handed players are there? what do you divide (-2/3) with to get 3/10 The sum of the tens digit and the hundreds digit of a number is three times the units digit. 1/5 of the sum of all three digits is 1 less than the units digit. Find all three-digit numbers that satisfy these conditions. Which of the following sentences is not punctuated correctly?A. She was the sweetest and most generous person I have ever met.B. This is the last long boring class I have left today.C. Dallas is a huge and sprawling city.D. Instead of carrying guns, the police in Britain carry long, metalnightsticks.SUBMIT I need help ASAP!!!!!!!! PLEASE CORRECT ANSWER!A student writes an incorrect step while checking if the sum of the measures of the two remote interior angles of triangle ABC below is equal to the measure of the exterior angle.A triangle ABC is shown. The base of the triangle extends into a straight line. The angle formed between this straight line and the edge of the triangle is marked as w. The angle adjacent to w is marked as z, and the other two angles inside the triangle are marked as x and y.Step 1: mx + my + mz = 180 degrees (sum of angles of a triangle)Step 2: mw mz = 90 degrees (corresponding angles)Step 3: Therefore, mx + my + mz = mw + mzStep 4: So, mx + my = mwIn which step did the student first make a mistake and how can it be corrected? (5 points)Select one:a. Step 1; it should be mx + my + mz = 180 degrees (sum of corresponding angles)b. Step 2; it should be mw + mz = 180 degrees (supplementary angles)c. Step 1; it should be mx + my + mz = 90 degrees (corresponding angles)d. Step 2; it should be mw + mz = 90 degrees (alternate exterior angle) Harder equationsSolve these equations:3x + 3 = -6. X= A prime number has two factors, itself and 1? * AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me what is the role of the grana in chloroplast? Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above A school has 617 students. Each class has between 28 and 32 students. Which is the best estimate of the number of classes in the school?14 classes20 classes30 classes60 classes Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT GMMThe numbers are36XAnd 46 degrees