What are the three delegate powers of the national government? ​

Answers

Answer 1

Answer:

(executive, legislative, and judicial)

Explanation:

Answer 2
Enumerated, implied and inherent powers!

Related Questions

How did Great Britain offer to help the US stop other European nations from establishing colonies in the Americas in
the early 1800s?
O by making a joint statement against France
O by making a joint statement opposing colonization
O by making a joint statement against Spain
O by jointly occupying Latin American republics for ten years

Answers

Answer:

i think c

Explanation:

Answer: The answer is b guys !

Explanation:

Locate a strike-slip boundary or transform boundary and what is happening there?

Answers

Answer:

I hope this help

Explanation:

Transform Plate Boundaries are locations where two plates slide past one another. The fracture zone that forms a transform plate boundary is known as a transform fault. Most transform faults are found in the ocean basin and connect offsets in the mid-ocean ridges.

The Queen Marie Antoinette was criticized for spending great sums of
money on clothing and jewelry while the citizens starved
- true or false

Answers

Answer- True
(Phrase: “let them eat cake”)

I think I’m correct I’m
Just double checking on this because I’m not sure .

Answers

Your answer is right ..

Answer: Yes it is correct

Explanation:

hello I would like to know who followed the believe of zoroastrianism

Answers

Answer:

me

Explanation:

Answer:

an  ancient  religion with many gods. monotheistic i think :P

Explanation:

Who was the major leader of the British troops at Yorktown

Answers

Answer:

Charles Cornwallis

Explanation:

Which question might a historian ask to investigate what happened?

How many people are in the photograph?
Where did the sinking take place?
Who took this photograph?
Why did the military use this kind of ship?

Answers

Answer:

Where did the sinking take place?

Explanation:

For a historian, there are certain aspects of the text or information that can authenticate and provide true facts. The most important questions that can ascertain the authenticity of the information are to ask the "who, what, where, how, and why" of the text or information.

And in 'investigating' the photograph of the sinking of the USS Maine in 1898, the question that a historian might ask to investigate is to ask "where the sinking take place". This will provide him/ her the detail about the ship's sinking location and thus help in further investigation of the event.

Thus, the correct answer is the second option.

Answer:

B

Explanation: Just took the test

Which of the following was central to maintaining and expanding all three islamic empires?a. Centrally located capitals B. A strong loyal military C. Banning slavery D. Islamic law

Answers

Answer:

B. A strong loyal military

Explanation:

The three Islamic empire's of the medieval times are the Mughal, the Safavid, and the Ottoman and all three had similar cultural background that was Turkish-Mongolian in nature.

The common factor between all three dynasties was that they were Muslim, had an agrarian economy and paid their soldiers in land grants.

A strong loyal military was central to maintaining and expanding all three islamic empires

how did columbus influence the tresty of tordesillas​

Answers

His discovery of the Pacific Ocean established Spain's claim to it and the land surrounding it, and spurred Magellan to seek a direct sea route to the Pacific and the East Indies beyond.

Lewis and Clark distributed these to American Indians in order to

Answers

Lewis and clark were put on the great expedition to search to the far west to look for more land as the united colonies grew, on their way the stop by many american indians. But, Lewis and clark were not the ones to drive them out of their land, it was when the colonists came to claim land from them.

Sorry if this had nothing to do with this question, i just read about the great expedition awhile ago and i remember lewis and clark trying to be friends with indians -Cvest

Answer:

illustrate the choice they faced between peace and hostility.

Explanation:

9. What role did Tubman have during the Civil War?

Answers

Answer:

a secret spy and military leader.

Please please help me on this I’m having a lot of trouble doing this

Answers

Answer:

Its the 2nd one bruv

Explanation:

Why it was important to Washington to keep America out of European affairs?

Answers

Upon becoming President of the United States, George Washington almost immediately set two critical foreign policy precedents: He assumed control of treaty negotiations with a hostile power—in this case, the Creek Nation of Native Americans—and then asked for congressional approval once they were finalized.

Answer:

Washington was leery of any such foreign entanglement, considering his country too weak and unstable to fight another war with a major European power.

Who posed the greatest threat to the Greeks and their way of life

Answers

Answer:

Xerxes, The Persian Leader

Explanation:

The Persian leader who presented the greatest threat to the Greek empire was named Xerxes.

The Greeks lived under Ottoman rule for several centuries, enduring cultural suppression and restrictions.

An Islamic nation with its capital in Anatolia, the Ottoman Empire steadily grew into Greece before capturing Constantinople (present-day Istanbul) in 1453. Greeks endured cultural repression and limitations while living for several centuries under Ottoman domination.

The early 19th-century Greek War of Independence eventually resulted in the creation of the modern Greek state. Greece has a rich and complicated historical background, with countless conflicts and outside forces influencing their way of life over the ages.

Learn more about Greek here:

https://brainly.com/question/15236408

#SPJ2

Which statement is the most likely conclusion you can draw from the coause-and-effect relationship shown in the diagram

Answers

This question is incomplete. Here's the complete question.

Which statement is the most likely conclusion you can draw from the

cause-and-effect relationship shown in the diagram?

Cause:

Humans learn to  domesticate plants  and animals.

Effect:

Humans live more settled  lives and develop  complex societies.

A)Humans continued to hunt and gather food even after they developed

complex societies.

B)Learning to domesticate plants and animals had little impact on human

societies.

C)Learning to domesticate plants and animals changed the way Humans lived.

D)Humans decided to move around more after the learned how to

domesticate plants and animals.​

Answer:

C)Learning to domesticate plants and animals changed the way Humans lived.

Explanation:

Humans having settled lives and developing complex societies is a result of the domestication of plants and animals.

Nomad societies used to need to move around to be able to hunt and gather food. However, when they learned to domesticate plants and animals they were able to settle to farm the land, and therefore complex societies developed. This means that farming skills did have a big impact on human advancement.

Answer:

show the diagram

Explanation:

Why did Texas face an economic depression in the late 1830s?

Answers

Answer:

Texas economy suffered greatly when the prices of their exports

Which natural recourse became more Available to the American public as a result of the railroad expansion

Answers

Answer:

The natural resource that became more available to the American public as a result of railroad expansion is coal. As a result of rail road expansion, it was discovered that coal can be used as a source of energy which was also the most cost efficient at that time.

Explanation:

The natural resource that became more available to the American public as a result of railroad expansion is coal. As a result of rail road expansion, it was discovered that coal can be used as a source of energy which was also the most cost efficient at that time.

Which direction did the Trail of Tears begin and end?

A) north to south

B) south to north

C) east to west

D) west to east

Answers

Answer:

B.

Explanation:

Answer:

i believe it was east to west because they were located around the southern colonies but then Andrew Jackson had kicked them off of the property or something like that and they ended up in Oregon which is in the west of the United States. Hope this is right :)

Explanation:

Which of the following individuals would likely have had the most education in the medieval society?

A villain's daughter
A nun
A knight's wife
A serf

Answers

Answer:

knits wife

Explanation:

Answer:

the answer would be a nun!!!

Explanation:

The position of the United States toward Latin America in the 1800s was specifically based on
Manifest Destiny.
imperialism.
the Monroe Doctrine.
the US Constitution.

Answers

Answer:

C: the monroe doctrine

Explanation:

the answer is the monroe doctrine

Edwards v. South Carolina is significant because it limited states' ability to
O protect protestors.
restrict the freedom of assembly.
O convict criminals.
restrict the freedom of the press.

Answers

the answer is restrict the freedom of press

Edwards v. South Carolina is significant because it limited states' ability to restrict the freedom of assembly. Thus, the ideal selection is option B.

What is Edwards v. South Carolina  case?

Edwards v. South Carolina case addressed the rights of protesters to assemble peacefully and express their views. The case arose when a group of African American students marched to the South Carolina State House to protest against segregation policies in the state.

The Edwards v. South Carolina decision established an important precedent for protecting the rights of citizens to engage in peaceful protests and demonstrations, and it helped to strengthen the First Amendment protections for freedom of assembly and expression.

It limited states' ability to restrict the freedom of assembly is the reason that Edwards v. South Carolina is significant. The correct answer is B.

Learn more about Edwards v. South Carolina case here:

https://brainly.com/question/29549047

#SPJ5

What was the impact of Augustus government spending on Rome?

Answers

Answer:Augustus reorganized Roman life throughout the empire. He passed laws to encourage marital stability and renew religious practices. He instituted a system of taxation and a census while also expanding the network of Roman roads.

Explanation:Oh and i found this on google and i found flash cards for you just look up your question and it will be there :)

Roman life was restructured under Augustus throughout the empire. He enacted legislation to promote stable marriages and revive religious customs. He expanded the Roman road system and put in place a revenue and census system.

What is Augustus government?

When Augustus, Julius Caesar's adopted son, seized power in 27 BCE, the Roman Republic became the Roman Empire. Augustus created an authoritarian system of government in which he served as the sole administrator and the ultimate arbiter of all important disputes.

He passed laws to encourage happy marriages and restore religious practices. He established a tax and census system and developed the Roman road network. In Rome, he established a permanent police force, fire department, and postal system.

He also acquired tribune authority for all time. Prior to then, he had accepted some tribune rights. One of the many helpful advantages of the vast amount of power he suddenly possessed was the chance to call the Senate.

Thus, Roman life was restructured under Augustus throughout the empire.

For more information about Augustus government, click here:

https://brainly.com/question/16254260

#SPJ2

who like high school of the dead

Answers

Answer:

it was rly good

Explanation:

Answer question 9 threw 20 for ALL my points (will mark brainlist)

Answers

Answer:

the settlers fished and sold it and they worked on a farm too

Explanation:

in the 1820s. and 1830s settlers took to the occupation of goldsmithing,Farming Textile and clothing along with locomotive works at rail ways

hope it helpful

what is significant about lexington and concord?​

Answers

Answer:

The Battles of Lexington and Concord signaled the start of the American Revolutionary war on April 19, 1775. The British Army set out from Boston to capture rebel leaders Samuel Adams and John Hancock in Lexington as well as to destroy the Americans store of weapons and ammunition in Concord.

Explanation:

The Battles of Lexington and Concord on 19 April 1775, the famous 'shot heard 'round the world', marked the start of the American War of Independence (1775-83). Politically disastrous for the British, it persuaded many Americans to take up arms and support the cause of independence.

This is an easy question pls help

Answers

I thought it was humanism ?

Answer: humanism


hope this helps

What was the significant result of the Plymouth Colony’s?

Answers

Answer:In September 1620, during the reign of King James I, a group of around 100 English men and women—many of them members of the English Separatist Church later known to history as the Pilgrims—set sail for the New World aboard the Mayflower. Two months later, the three-masted merchant ship landed on the shores of Cape Cod, in present-day Massachusetts.

In late December, the Mayflower anchored at Plymouth Rock, where the pilgrims formed the first permanent settlement of Europeans in New England. Though more than half of the original settlers died during that grueling first winter, the survivors were able to secure peace treaties with neighboring Native American tribes and build a largely self-sufficient economy within five years. Plymouth was the first colonial settlement in New England.

Journey to the New World

Mayflower

The Mayflower in Plymouth Harbor.

Barney Burstein/Corbis/VCG/Getty Images

Among the group traveling on the Mayflower in 1620 were close to 40 members of a radical Puritan faction known as the English Separatist Church. Feeling that the Church of England had not sufficiently completed the necessary work of the Protestant Reformation, the group had chosen to break with the church altogether. The Separatists had sought religious freedom before, fleeing England in 1607 and 1608 to settle in the Netherlands, first in Amsterdam and later in the town of Leiden, where they remained for the next decade. Wanting to secure their English language and heritage, and seeking more economic opportunity, the group–later known as the Pilgrims–laid plans for a voyage to the New World aboard the Mayflower.

Did you know? Three more ships traveled to Plymouth soon after the Mayflower, including the Fortune (1621), the Anne and the Little James (both 1623). Passengers on these first four ships were called the "Old Comers" of Plymouth Colony, and were given special treatment in later colonial affairs.

The Pilgrims had originally signed a contract with the Virginia Company to settle near the Hudson River, but rough seas and storms prevented the ship from reaching its initial destination. After 66 days, it reached the shores of Cape Cod, anchoring at the site of Provincetown on November 21. The Pilgrims sent an exploratory party ashore, and on December 18 docked at Plymouth Rock, on the western side of Cape Cod Bay. The explorer John Smith had named the area Plymouth after leaving Jamestown, the first permanent English settlement in the New World. The settlers decided the name was appropriate, as the Mayflower had set sail from the port of Plymouth in England.

Surviving the First Year in Plymouth Colony

For the next few months, many of the settlers stayed on the Mayflower while ferrying back and forth to shore to build their new settlement. In March, they began moving ashore permanently. More than half the settlers fell ill and died that first winter, victims of an epidemic of disease that swept the new colony.

Soon after they moved ashore, the Pilgrims were introduced to a Native American man named Tisquantum, or Squanto, who would become a member of the colony. A member of the Pawtuxet tribe (from present-day Massachusetts and Rhode Island) who had been kidnapped by the explorer John Smith and taken to England, only to escape back to his native land, Squanto acted as an interpreter and mediator between Plymouth’s leaders and local Native Americans, including Chief Massasoit of the Pokanoket tribe.

The First Thanksgiving

The First Thanksgiving

The first Thanksgiving.

Barney Burstein/Corbis/VCG/Getty Images

In the Fall of 1621, the Pilgrims famously shared a harvest feast with the Pokanokets; the meal is now considered the basis for the Thanksgiving holiday. It took place over three days between late September and mid-November and included feasting as well as games and military exercises.

Most of the attendees at the first Thanksgiving were men; 78 percent of the women who traveled on the Mayflower perished over the preceding winter. Of the 50 colonists who celebrated the harvest (and their survival), 22 were men, four were married women, and 25 were children and teenagers.

The Pilgrims were outnumbered more than two to one by Native Americans, according to Edward Winslow, a participant who attended with his wife and recorded what he saw in a letter, writing: “many of the Indians coming amongst us, and amongst the rest their greatest king Massasoit, with some ninety men.”

Explanation: .,.

The Greensboro lunch counter sit-in of 1960 reflected mounting frustration at the slow pace of racial change felt by African American people.
True or false?

Answers

That is ummmn false and not true

The statement is false.

The Greensboro lunch counter sit-in of 1960 reflected mounting frustration at the slow pace of racial change felt by African American people.

What happened at the lunch counter sit-ins?

The Greensboro take a seat-in changed into a civil rights protest that started in 1960, while younger African American college students staged a take a seat-in at a segregated Woolworth's lunch counter in Greensboro, North Carolina, and refused to go away after being denied service. The sit-in motion soon spread to university cities at some stage in the South.

The sit down-in at Greensboro, North Carolina, in 1960: reflected mounting frustration on the slow pace of racial alternate. through the end of 1960, a few 70,000 demonstrators had taken component in sit-ins throughout the South to protest: segregation.

Learn more about Greensboro here https://brainly.com/question/22307822

#SPJ2

Please select the word from the list that best fits the definition a very influential legal code of the Byzantine Empire​

Answers

Answer: justinian code

Explanation:

Answer:

justianian code

Explanation:

Which African country faced a serious genocide in 1994, during which almost one million people were killed?
A.
Rwanda
B.
Zaire
C.
the Democratic Republic of the Congo
D.
South Africa

Answers

Answer:

A. Rwanda

Explanation:

Answer:

rwanda

Explanation:

Other Questions
Louisa spent 5/8 of an hour on math homework, 1/6 of an hour on science homework, and 7/12 of an hour on English homework. How much time total did she spend on homework? Pls help Thx I neeed help pleaseeee GUse the graph to answer the question.y6R543-21O3What are the coordinates of point R on the graph? Choose numbers to move to the lines to answer the question,56012 I need answer as quick 0.45 g of hydrated sodium carbonate crystals were heated until 3.87 of anhydrous power remained.How many moles of water are there in one mole of hydrated salt? Will mark as brainliest!!!!!!!!!! X3.1.PS-7QuestionA local little league has a total of 60 players, of whom 40% are right-handed. How manyright-handed players are there? what do you divide (-2/3) with to get 3/10 The sum of the tens digit and the hundreds digit of a number is three times the units digit. 1/5 of the sum of all three digits is 1 less than the units digit. Find all three-digit numbers that satisfy these conditions. Which of the following sentences is not punctuated correctly?A. She was the sweetest and most generous person I have ever met.B. This is the last long boring class I have left today.C. Dallas is a huge and sprawling city.D. Instead of carrying guns, the police in Britain carry long, metalnightsticks.SUBMIT I need help ASAP!!!!!!!! PLEASE CORRECT ANSWER!A student writes an incorrect step while checking if the sum of the measures of the two remote interior angles of triangle ABC below is equal to the measure of the exterior angle.A triangle ABC is shown. The base of the triangle extends into a straight line. The angle formed between this straight line and the edge of the triangle is marked as w. The angle adjacent to w is marked as z, and the other two angles inside the triangle are marked as x and y.Step 1: mx + my + mz = 180 degrees (sum of angles of a triangle)Step 2: mw mz = 90 degrees (corresponding angles)Step 3: Therefore, mx + my + mz = mw + mzStep 4: So, mx + my = mwIn which step did the student first make a mistake and how can it be corrected? (5 points)Select one:a. Step 1; it should be mx + my + mz = 180 degrees (sum of corresponding angles)b. Step 2; it should be mw + mz = 180 degrees (supplementary angles)c. Step 1; it should be mx + my + mz = 90 degrees (corresponding angles)d. Step 2; it should be mw + mz = 90 degrees (alternate exterior angle) Harder equationsSolve these equations:3x + 3 = -6. X= A prime number has two factors, itself and 1? * AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me what is the role of the grana in chloroplast? Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above A school has 617 students. Each class has between 28 and 32 students. Which is the best estimate of the number of classes in the school?14 classes20 classes30 classes60 classes Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50