The Mystery of Loch Ness
By Kayden Mitchell

Of all the mysteries in the world, none has been as popular as that of the Loch Ness Monster. Perhaps the biggest mystery is whether it is convincing evidence or a simple desire to believe that keeps the myth alive.

Loch Ness is a lake in Scotland. The loch, or lake, is known for sightings of a mysterious monster. Most who see this monster, known as Nessie, describe something with a long neck and several humps above the water. Sometimes the "monster" is moving in these sightings, and sometimes it is still. Many have suggested that Nessie might be a plesiosaur (plea-see-a-soar), an aquatic dinosaur that was trapped in the loch after the last ice age.

The plesiosaur theory presents several problems. First, the plesiosaur is an air breather. Such a creature would need to surface often and, therefore, be seen more frequently. Second, it's unlikely that the same creature has lived in the loch since the last ice age. Today's creature would have to be the offspring of an original plesiosaur trapped long ago. This would suggest multiple creatures in the loch (needed to produce offspring). Again, sightings would be more frequent if this were the case.

So from a purely logical stand point, the existence of such a large and ancient creature is unlikely. But assume for a minute that it is possible. What would a plesiosaur need to live in an enclosed lake?


Tropical waters: Scientists believe plesiosaurs were warm-blooded. Like crocodiles and alligators, plesiosaurs would need to live in warm waters. The loch is very cold with temperatures averaging about 40 degrees Fahrenheit (4.4 Celsius).
Food: Like other warm-blooded creatures, plesiosaurs would need a large quantity of food. If there is a group of Nessies, then even more food would be needed. Because the loch is full of silt (underwater dust) not much light gets into the deepest areas. So the food chain, which would depend on plankton, is very weak at its base. As a result, there is probably not enough food to support such a large creature.


However, the plesiosaur theory is not the only one. Many other ideas attempt to explain the sightings and "photographs." But two separate sonar surveys of the loch have not found any evidence of a creature larger than a salmon. The last survey1, completed in 2007 by the British Broadcasting Company (BBC), involved 600 different sonar beams. Using satellite navigation systems, the team made sure every inch of the loch was searched. The team found nothing.

With cell phones and digital cameras, one would think that sightings of Nessie would increase. This has not happened. The BBC team believes the legend of Nessie has endured because people see what they want to see. To prove this, the team used a fence post, raising it before groups of tourists. Afterwards several of the tourists asked to draw pictures of what they had seen drew pictures of a monster's head.



Which best summarizes the results of sonar surveys?
The simple tools cannot search at depths where the creature lives.
The satellite navigation could not map the entire lake bottom.
There are too many large salmon in the loch to find much else.
They have found no evidence of anything bigger than a salmon.
Question 2(Multiple Choice Worth 5 points)

Answers

Answer 1

Answer:

They have found no evidence of anything bigger than a salmon.

Explanation:

The answer to the question you were given can be found in the paragraph that starts with the sentence However, the plesiosaur theory is not the only one. The third sentence of this paragraph states that sonar surveys of Loch Ness haven't discovered any creatures larger than a salmon. This is why the fourth statement best summarizes the results of sonar surveys.

The rest of the options are incorrect as these statements can't be found in the text.


Related Questions

Which of the following BEST expresses Jonas's point of view about the
upcoming Assignment process? I NEED HELP ASAP

Answers

Where’s the assignment ??

Answer: Gabe's presence prompts Jonas' family's conversation about Birthmothers because Lily hopes that she will be assigned to be a Birthmother when she becomes a Twelve. During the conversation, we learn that Birthmothers give birth to three babies over a three-year period.

Explanation:

Points and Brainliest Giveaway!

Write a 2 paragraph summary on the Pardoner's tale from Chaucer's "The Canterbury Tales."

Answers

hii

At the beginning of the tale, the pardoner gives the sermon describing the kind of sins the people he’s going to tell the tale of indulges in.

Gluttony, the in that had Adam and Eve were thrown out of Eden; drunkenness that makes a person lose his conscience; gambling that kindles greed in people; and swearing. After the sermon, he returns to the tale.

Three friends were drinking when they hear the funeral knell and one of them tells the others that one of their old friends has been killed by a person named death.

All of them resolve, in their drunkenness, to find Death and kill him. They go on to search for Death. On the road, they meet an old man who seems upset and has been waiting for death to take him. They ask him he has seen Death and he guides towards a tree where he has left death some time ago.

They reach the tree and find eight bushels of gold. Astonished to have found so much gold without any owner around, they decide to transport the gold in the eight so nobody finds out about it. They draw lots to send someone to bring wine and bread in the meantime.

The youngest one is chosen by the fate to go to the town. He goes and sly one of the rest two proposes to kill the one gone to the town so as to expand their share of gold, the other one agrees.

The youngest has also planned to kill the other two to become one of the richest in the world. So, he buys the strongest poison and mixes that in the two bottles of wine and keeps one pure for himself.

As he reaches around the tree, other two come from behind the tree and knife him and he’s dead. Feeling as to have expanded their share of gold they drink wine to celebrate and both of the pick the poisoned bottle. Soon they lay dead around their dead friend leaving the gold for nobody.

The pardoner concludes his tale be warning people of the sin of avarice.

HOPE IT HELPS YOU OUT PLEASE MARK IT AS BRAINLIEST AND FOLLOW ME PROMISE YOU TO FOLLOW BACK ON BRAINLY.IN

Answer:

Following the Physicians Tale, the Host began to swear as if he were mad, wishing a shameful death on the judge and his advocates, and concluding that the cause of the maidens death was her beautee. The Host pronounced the tale a piteous one to listen to, and prayed to God that he protect the Physicians body. The Host, concluding that he has almost caught a cardynacle (had a heart attack) after the brutality of the Physicians Tale, decides that he must hav…

Explanation:

WILL GIVE BRAINLIEST, 5 STARS, AND THANKS!!

Which aspect of a novel most likely has little effect on character development and plot?

The antagonist
The conflict
The point of view
The setting

Answers

Answer:

I'd say point of view.

the antagonist and conflict should always have effect on a character as it effects their lives, and lets say the setting is in a run down, or poor place they're stuck in.

How does the authors use of characterization develop the passage?
A. It highlights the internal conflict that Peter faces throughout the narrative.
OB.
It highlights Peter's individuality, which distinguishes him from normal social expectations
C. It highlights the emotional connection that Peter shares with the narrator.
D. It highlights Peter's background, which plays an important role for developing the mood.
Reset
Next

Answers

Answer:

B.  It highlights Peter's individuality, which distinguishes him from normal social expectations.

Explanation:

The author uses characterization to develop the passage by highlighting Peter's individuality, which distinguishes him from normal social expectations.

From the excerpt, we can see that the narrator revealed Peter's individuality. He highlighted how usually bespattered his mussy clothes with ink or sometimes with soup which is to the dismay of those of his friends and relatives who knew him. His characteristics actually distinguished him from what was expected in the society. A full grown man soiling his clothes is not something that is socially expected.

Characterization in literature has to do with the description of the distinctive features of someone. Dreiser uses characterization of Peter to develop the passage.

Answer:

the answer is d but the same as hers

Explanation:

NEEED HELPPPPPPPPPP ASAPPPP 20 pointssss

Answers

Answer:

It means that you need to be conifednet and beilive in yourself. To never give up and learn from your mistakes. Never lose confidence especially in these times.

Explanation:

Answer: The sentences above mean that if going to become friends with someone else you have to learn how to like yourself and know yourself before you become friends with someone else. Next time, you can use it by encouraging yourself to do things and continue to stay positive!

Explanation:

I hope this helped! have a great day and stay positive! may i please have brainliest?

What is the most likely reason that the author included the section with information about the controversy surrounding Molly Pitcher?
The author thought that the controversy was outrageous and that it should be discredited and discontinued.
The author believed that the controversy was just as important as the contribution that Mary made to the war effort.
The author wanted to prove that the controversy should not take away from the importance of Mary as a Revolutionary War figure.
The author believed that Mary Ludwig Hays McCauley was not the actual Molly Pitcher and wanted to expose the falsehood.

Answers

Answer:The answer is C

Explanation:

.

The most likely reason was that C. The author wanted to prove that the controversy should not take away from the importance of Mary as a Revolutionary War figure.

It should be noted that Molly Pitcher was a common name during the Revolutionary War.

The reason that the author included the section with information about the controversy surrounding Molly Pitcher was that the author wanted to prove that the controversy should not take away from the importance of Mary as a Revolutionary War figure.

Read related link on:

https://brainly.com/question/23129657

will computer r eplace teacher in future advatages and disadvantages . essay​

Answers

Answer:

Technology replacing teachers: Advantages and Disadvantages

In modern day world, technology is a word that we start our day with. Be it any sphere of life, technology has conquered it all. With new advancements and modern techniques, technology has engulfed our education system and is replacing teachers with robot tutors, classrooms with satellite classes, and interactive sessions with online learning platforms.

The advantages of technology replacing teachers is that each student now have access to education. Gone are the days when students from remote areas had to travel miles to attend classes. Thanks to the advancement in technology students now have access to study material which can be read anytime as per his/her convenience. Every student has a different learning pace, when in class, a teacher cannot individually mentor each student and might overlook small errors made by students. However, this is not the case with robot tutors. There are various cloud apps and software that guide students according to their individual needs. Now a student is not restricted to just a 6 hour classroom to have access to knowledge, the AI software of teaching has made the teaching-learning process much simpler and convenient. From an institution’s point of view, it will also save the cost of brick and mortar buildings, retirement benefits, health benefits and even pay raises.

By far we read that how technology can be a great tool for learning. But it cannot replace the value that a human provides in nourishing a child. The replacement of human teachers with artificial intelligence comes with its own set of disadvantages. There’s no denying the fact that technology cannot give an emotional support that is required for the all-round development of a student. A machine teacher can provide us with knowledge of any subject but it cannot share with us the real-life experiences that a human can guide us with. A computer program will never be able to build an emotional relationship which is crucial for teaching-learning process. it is programmed to follow a certain set of rules and instructions and will do so mechanically.

The bottom line is that there may be number of benefits of using technology in the classroom but computer technology is simply aiding to the teaching learning process, it cannot completely take over the role of human teachers.

Lines and stanzas in a narrative poem are like:
scenes and acts in a play
chapters in a novel
sentences and paragraphs in a short story
all of the above

Answers

Answer:

D

Explanation:

Lines and stanzas in a narrative poem are like scenes and acts in a play, chapters in a novel and sentences and paragraphs in a short story. Hence, option D is correct.

What is a narrative poem?

Narrative poetry is a term used to describe a poem that tells a story. It uses literary techniques that one may commonly find in a poem, such as rhyme, rhythm, similes, and metaphors, to create a narrative. Typically longer than other forms of poetry, narrative poems tell a single, overarching story much like a novel.

A narrative poem's narrator is typically the only speaker and describes the entire story from beginning to end. For instance, over the course of 18 stanzas, the sorrowful man who tells the story in Edgar Allan Poe's "The Raven" describes his strange meeting with a raven and his descent into despair.

Thus, option D is correct.

For more information about narrative poem, click here:

https://brainly.com/question/160000

#SPJ2

Which sentence is written correctly?


a
Eren Said, "I can't wait to be old enough to join the Scout Regiment".
b
Eren said, "i can't wait to be old enough to join the Scout Regiment."
c
Eren said, "I can't wait to be old enough to join the Scout Regiment."
d
Eren said "I can't wait to be old enough to join the Scout Regiment."

Answers

The answer is C.Eren said,

The Song of Wandering Aengus

by William Butler Yeats

I went out to the hazel wood,
Because a fire was in my head,
And cut and peeled a hazel wand,
And hooked a berry to a thread;
And when white moths were on the wing,
And moth-like stars were flickering out,
I dropped the berry in a stream
And caught a little silver trout.

When I had laid it on the floor
I went to blow the fire a-flame,
But something rustled on the floor,
And someone called me by my name:
It had become a glimmering girl
With apple blossom in her hair
Who called me by my name and ran
And faded through the brightening air.

Though I am old with wandering
Through hollow lands and hilly lands,
I will find out where she has gone,
And kiss her lips and take her hands;
And walk among long dappled grass,
And pluck till time and times are done,
The silver apples of the moon,
The golden apples of the sun.

Read these lines from "The Song of Wandering Aengus."

Though I am old with wandering
Through hollow lands and hilly lands,
I will find out where she has gone,

How does Aengus's continued search for the girl affect the meaning in the poem?


It shows he is trying to get in touch with the beauty and life he caught a glimpse of.


It reflects his obsession with a woman he once knew and cannot forget.


It suggests that Aengus misses the life he had when he was a young boy.


It reflects his desire to recreate an odd experience he once had.

Answers

Answer:

Beautiful

Explanation:

As a student ,how does writing helps you communicate your message with clarity and accuracy?

Answers

Answer: I think it helps us express our self within writing and also help us improve writing

Explanation:

Knowledge

Because your eyes are so important. You must take care of them.

What is the BEST way to combine the information above?
A.
Because your eyes are so important, and you must take care of them.
B.
Because your eyes are so important, you must take care of them.
C.
Because your eyes are so important, then you must take care of them.
D.
Because your eyes are so important that you must take care of them.

Answers

Answer:

B. Because your eyes are so important, you must take care of them.

Explanation:

Answer:B

Explanation:because your eyes are so important, you must take care of them.

Refer to “The Lady, or the Tiger?”

no matter how the affair turned out the youth will be disposed of and the king would take an aesthetic pleasure in watching the course of events which will determine whether or not a young man had done wrong in allowing himself to love the princess.


A) The king is considerate of his daughter

B) The daughter is not considerate of her lover

C) The king is considerate of the young man

D) The young man is not considered of the princess

E) The King is not considered of his daughter

Answers

Answer:

E.

Explanation:

Please help

SUPPORTING EVIDENCE #1 - Express an example, fact, or statistic to support your reason.
•online Americans tend to have 664 ties on average, compared with an offline
average of around 506.
.
ADDITIONAL DETAIL - Add an addition detail to explain this example, fact, or statistic.

Answers

Social networking sites (SNS) provide people with the opportunity to friend members of their overall network of family members, coworkers, and other acquaintances. Much has been made of the use of the word “friend” in this context. Those who are listed as friends on SNS may indeed be friends in the traditional sense, but they can also be old acquaintances (e.g., from high school) or very casual connections between people who have never have met in person. Some worry that as a result of using these services, people may become more isolated and substitute less meaningful relations for real social support. Others believe this might enrich and expand relationships. Here below are our findings on all of this.

1. Which of the following sentences from the passage has a dependent clause
underlined?

Answers

Answer:D

Explanation:

A dependent clause is a clause that can’t stand alone and is dependent on an independent clause to form a complete sentence.

Option D fits the question.

How does the structure support the big idea in this section of the poem? Check all that apply.

The lines seem to float on the page like birds feathers.

Answers

Answer:

Sorry brother !

My request is - Can you please post a picture of your question...

Then, I will definitely answer...

what are two ways Stalin uses logical fallacies or other forms of faulty argumentation in his radio speech? describe them.

Answers

Answer:

One form of Stalin faulty argumentation is when he used the logical fallacy of post hoc ergo prompter hoc to show his nonviolent pact. He also used fallacy slippery slope when he demands that the Sovien Union battle with everything that they have so that they come out victorious.

Explanation:

Stalin 2 logical fallacies

The ways that Stalin uses logical fallacies include when he used the logical fallacy of post hoc ergo prompter hoc to show his nonviolent pact and slippery slope fallacy.

What is fallacy?

It should be noted that fallacy simply means an argument that flawed. It is not logically sound.

Here, the ways that Stalin uses logical fallacies include when he used the logical fallacy of post hoc ergo prompter hoc to show his nonviolent pact and slippery slope fallacy.

Learn more about fallacy on:

https://brainly.com/question/4255659

#SPJ2

Which earth science lesson is especially appropriate for primary grades

Answers

Answer:

I did gummy worm science when I was that age

Answer:

volcanoes!!

Explanation:

hope this helps!

How does watching the stage version of the Crucible enhance (or help) your understanding of what is happening in the play.

Answers

Answer:

if u are watching stage version u probably understand what is happening inside the story of the text

what do you call a group of words that function as a single part of speech​

Answers

Answer:

A group of words that does not contain a subject and predicate and acts as one unit as a part of speech (noun phrase, verb phrase, prepositional phrase, verbal phrase).

Explanation:

Answer:

A phrase

Explanation:

Will give brainliest!! The next question refers to the following passage. The sentences have been numbered to help you identify them more easily
(1) As she was driving to visit her twin, Joyla had a strange feeling that something bad was going to happen.
(2) Meanwhile, Kayla hod the same exact premonition,
(3) Worried about her sister, Kayla called Joyle's cell phone.
(4) Because she took her eyes off the road to answer the phone call, Jayla lose control of her car and crashed through the front of Kayla's house,
Which sentence features an introductory phrase that explains why the main action happened? (5 points)
a Sentence 1
B Sentence 2
C Sentence 3
D Sentence 4

Answers

Answer:D

Explanation:She took her eyes off the road, causing the crash

Answer:

D.

Explanation:

Because is why the main action happened

English 12 3.3.9 Practice Sem 1
This is an comparative essay. Please help due at 11:59 tonight. Will mark brainliest.

Answers

Answer:

Elaborate more!

Explanation:

which or the folowing is a teniuge to for ading variety to your writeing
a slect a nicer font
b reviewing and chaneing sentnces
c use deffrient langue
d ues nonrepetiton for efect

Answers

Answer: A.

Explanation: a different font could allow u to get not only more ideas but also a better thought pattern

3. A
person with diverse interests probably avoids
A. boredom
B. disappointment
C. contact sports

Answers

Answer:

A

Explanation:

What is the theme of What kind of Asian are you poem by Alex Dang?

Answers

Answer:

what's the poem name??? then

Explanation:

and plz, tell me which once is the syllabus from?

Please help me!!!!!!

Answers

Answer:

.

Explanation:

:D I think this will be all right.

I'll give brainliest

What are modifiers in a sentence?
words or phrases that transition from one idea to the next
words or phrases that describe something else
words or phrases that evoke emotions
words or phrases that illustrate a point

Answers

The answer is

B. Words or phrases that describe something else.

For example, in the sentence “We’re going to get vegetarian burgers after work.” the word “burgers” is modified by the word “vegetarian”.

1. What is the time signature of the song Leron-Leron Si
A 3/4 B. 6/8 C. 2/4 D. 4/4​

Answers

Answer:

D

Explanation:

I didn't listen to the entire song (though it is very cheerful, with a nice melody), but everything I heard was in a nice 4-beat oom-pah rhythm (or boom-chuck rhythm, or bass-chord rhythm), and I would give it a 4/4 time signature.

Answer: ( D) 4\4

Explanation:

1. True or false: The setting of a story can change as the
story develops
A. True
B. False

Answers

Answer:

True

Explanation:

The setting is just the surroundings where an action takes place.

Answer:

A. True

Explanation:

The setting of a story will change as the story develops because a story isn't going to stay in one setting most of the time.

Select the correct answer.
What is true about drowning?
Ο Α.
It is a leading cause of death globally.
Around 4,000 children die from drowning in the United States each year.
OB.
OC. It happens in all types of water.
OD
All of the above

Answers

Answer:

D all of the above

Explanation:

Answer:

D. All of the above

Explanation:

Other Questions
Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT 20 POINTS!!!!!!Which of the following is probably not an effect of urban sprawl?A. the loss of habitats and biodiversityB. decreased shortages of water and other resourcesC. increased temperatures in summer monthsmore air pollution that is harmful to human healthPlease select the best answer from the choices providedABCD GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 plz help i need help im failing Simplify as far as possible.182 Part B: A triangle has vertices A (-2, 3), B (0, 0), and C (1, 2). What are the coordinates of the vertices if the original triangle is dilated by a scale factor of 3 and then reflected over the x-axis? A medium artichoke contains about 14% of the recommended amount of a certain mineral an average adult should have each day. About how many grams of the mineral should the average adult have each day? I walked into that reading room a happy healthy man. I crawled out a decrepit wreck Complete each statement by choosing the correct family member that best fits the description.Select the correct answer from each drop-down menu.El padre de mi padre es miEl hijo de mi ta es miLa madre de mi madre es mivEl hijo de mi padre es miLa hija de mi to es mi Who are the most aggressive of the types we looked at? what's the pagathorium theorem A power pole 10 m tall casts a shadow 8 meters long, at the same time that a building nearby casts a shadow 14 m long. How tall is the building? A tank containing oxygen, carbon dioxide, and nitrogen gases has a total pressure of 6.7atm. If the O2 has a pressure of 3.0 atm and the carbon dioxide has a pressure of 1.2what is the partial pressure of the nitrogen gas? The movement of water in or out of the cell membrane without the use of ATP.Diffusion Facilitated diffusion OsmosisExcoytosis PARLER/CRIRE Les personnes suivantes n'ont pascertaines choses. Dites quelle activit de la listeelles ne peuvent pas faire.Marc n'a pas sa raquette.Il ne peut pas jouertudierau tennis.couter le CD1. Nous n'avons pas de vlo.nager2. Je n'ai pas mon maillotde bain.jouer au tennis3. ric n'a pas de couteau. prendre des photos4. Tu n'as pas de fourchette,manger un steak5. Nous n'avons pas noslivres.manger des spaghetti6. Alice n'a pas de portable. faire une promenade7. Les touristes n'ont pas la campagned'appareil-photo.tlphoner8. Vous n'avez pas d'ordinateur.surfer sur le Net9. La n'a pas son baladeur. Escoger Circle the item that does not belong.1.c. la papelera Ca. la tizab. la pluma2.a. la geografac. la economab. el libroB3.a. la mochilab. la puertac. la ventana4.a. la residencia estudiantilb. la casac. la tarea5.a. la pizarrab. el trimestrec. el mapa6.a. el inglsb. el espaolc. el arte 1. Kaleigh notices when she goes to the beach that sometimes the water rises as high as the pier. At other times of the day, the water barely covers the pillars under the pier. These differences in water level are primarily due to the gravitational influence of which of the following? a. The Earths revolution b. The Moon c. asteroids d. comets A cube with a volume of 75 cm is dilated bya factor of 5.What is the volume of the dilated cube?Enter yOur answer in the boxcm In his Farewell Address, Washington shared his feelings about the US and foreign diplomacy. He believed inA - neither trade or political involvement B - both trade and political involvement C - political involvement with foreign countries,but no tradeD - trade with foreign countries, but no political involvement