How many different ways can the 23 homologous pairs in a human germ cell arrange themselves during Metaphase I?

Answers

Answer 1

Answer:

eight million

Explanation:

Answer 2

Eight million different ways can the 23 homologous pairs in a human germ cell.

What is Homologous pairs?

One of a pair of chromosomes with the same gene sequence, locations, chromosomal length, and centromere placement is referred to as a homologous chromosome. One paternal and one maternal chromosome make up a homologous pair.

A somatic cell of a human has a total of 46 chromosomes in its nucleus. The father inherits half of them (22 autosomes Plus X or Y chromosome), while the mother inherits the other half (22 autosomes + X chromosome).

A female typically has 23 homologous chromosomes, compared to a male's 22. This is due to the fact that men' X and Y sex chromosomes are not identical. During meiosis, homologous chromosomal pairing is crucial.

Therefore, Eight million different ways can the 23 homologous pairs in a human germ cell.

To learn more about homologous chromosomes, refer to the link:

https://brainly.com/question/28459162

#SPJ2


Related Questions

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

Which human activity negatively affects the stability of the environment?

Answers

Answer:

Some human activities that cause damage (either directly or indirectly) to the environment on a global scale include population growth, overconsumption, overexploitation, pollution, and deforestation, to name but a few.

Explanation:

Brainliest?

why does the temp of the air increase with the height of the stratosphere?

Answers

Answer:

The hot air rises and the cool air falls

Explanation:

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?

Answers

The name of the gas is t

Which blood component fights and destroys disease-causing bacteria and
viruses?

Answers

Answer:

white cells

Explanation:

the answer is white blood cells

A simple life cycle is one in which the offspring look similar to their parents.
True
Or
False

Answers

False — life cycles have to do with birth to death progressions, not genetic traits.

If you were on the ISS (International Space Station), how would you know that a solar eclipse took place on Earth?

Answers

Answer:you could ask your family or look it up you ar probably right next to a sadelite

so connection should be pretty good

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil

Answers

Answer:

B)Magma

Explanation:

When a strong acid is added to a strong base a_________________ reaction occurs in the product will have a PH closer to_____

A. Neutralization,7
B. Ionic,0
C. Concentration,14

Answers

Answer:

A

Explanation:

Acids and bases when mixed neutralize eachother. and 7 is neutral on the PH scale

4 points
The inferred temperature and pressure of Earth's
interior at a depth of 3,000 kilometers are
approximately
(1) 1000°C and 0.5 million atmospheres
(2) 1000°C and 1.0 million atmospheres
(3) 5000°C and 1.5 million atmospheres
(4) 5000°C and 3.0 million atmospheres

Answers

Answer:

(4) 5000°C and 3.0 million atmospheres

Explanation:

The inferred temperature is 5000°C and pressure of Earth's  interior is 3.0 million atmospheres at a depth of 3,000 kilometers. At the depth of 3000 kilometers, core of the earth is present which is very hot and it is mostly consist of iron. The inner core has a radius of about 1,220 kilometers while the outer core is about 1,400 miles thick which comprise of iron, Nickle, gold, platinum, and uranium elements.

What are three differences between rocks and soil

Answers

Answer:

Rocks are made of one or more minerals. based on the way the rock was formed: sedimentary metamorphic and igneous Soil is formed of fine rock particles mixed with air, water and particles from dead plant and animal matter.

Two offspring from same parents can have different phenotypes. How is this possible?​

Answers

Answer:

Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. However, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.

Explanation:

Overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

What is heterozygote?

Heterozygote is defined as a person, animal, or other thing possessing a pair of different alleles of a specific gene, one of which is dominant and the other recessive. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype.

The explanation is connected to the fact that each parent has two different gene pools. Furthermore, only 50 percent of each parent's DNA is transferred to their offspring. and that the portion that is passed down is random. Every child has a unique set of genes thanks to the interaction of all these influences.

Thus, overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

To learn more about heterozygote, refer to the link below:

https://brainly.com/question/12891396

#SPJ2

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.

Answers

Answer:

can I write an essay

Explanation:

On April 20, 1902, Marie and Curie with success isolate radioactive  metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic  radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.

Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.

we need a picture ..

Would you expect the stomata of a desert cactus or the stomata of a water lily plant to close during the day?

Answers

A water lily will have more stomata. A desert cactus will have very few stomata, because in deserts plants face water shortage so in order to avoid loss of water cacti have adapted to the desert environment by possessing few stomata.

The stomata of a desert cactus will close during the day.

STOMATA:

The stomata (singular- stoma) are structures on the leaves of a plant that helps in gaseous exchange i.e. entry and exit of CO2 and O2 gases.

The stomata, however, when opened allows the passage of water vapor from the plant. Hence, plants utilize the opening and closing of stomata to regulate water loss.

Desert cactus is a xerophytic plant meaning that they can survive in low water conditions. One way they adapt to their desert environment, which is characterized by low humidity, is by the closure of their stomata during the day.

Therefore, the stomata of a desert cactus will close during the day.

Learn more at: https://brainly.com/question/3387375?referrer=searchResults

The image below shows plant cells.
What feature of cells is best demonstrated in the image?
OA Cells are the basic units of structure and make up tissues.
OB. All organisms are made up of a large number of cells.
OC. All organisms have cells with different shapes and functions.
OD. Cells are formed from other cells within the same tissue.
2021 Edmentum. All rights reserved.

Answers

C.All organisms have cells with different shapes and functions

Describe some of the reasons for exploring the mid-Cayman ridge.

Answers

Answer:

Life on Earth goes back almost 4.1 billion years, but photosynthesis as characterized by cyanobacteria only appeared around 3.5 billion years ago (Ga). Since life on Earth predates photosynthesis, the exploration of this deep-water environment that lacks any source of light could provide information on what those life forms looked like.

Explanation:

This was the answer on edge

The major reason for exploring the mid-Cayman ridge is to provide

information on what those life forms looked like.

What is Photosynthesis?

This is the process in which plants manufacture their food in the presence

of sunlight and other compounds.

The mid-Cayman ridge which is present in a deep water environment has

lacks any source of light has some life-forms present. The exploration was

to find out the type of life forms present and how they appear.

Read more about Mid-cayman ridge here https://brainly.com/question/2747950

Certain gene mutations can cause genetic disorders. However the same gene can also have a positive effect. The genetic mutation that led to sickle cell anemia can also give its carriers protection from which of the following diseases?
A.
strep throat
B.
Type I diabetes
C.
malaria
D.
hemophilia

Answers

B is the correct answer

Answer:

its malaria

Explanation:

I got it wrong and it showed me that it was malaria

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

The dodo bird is now extinct. What factor would not have led to its extinction?

Answers

Answer:it was well adapted to living on the island of Mauritius

Explanation:

In mature animals when do cells still need to differentiate?

Answers

Answer:

As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.

Explanation:

''.''

In mature animals cells differentiate during : Repair and replacement of  animal cells

Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.

While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.

Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.

Learn more : https://brainly.com/question/19015367

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

True of False: Marsh was able to prove that animals changed over time.

Answers

Answer:

True

Explanation:

Hope this helps :D Have a great day..can i hav brainliest?

I think the answer is true


:):):):):):):):)

Which best describes the importance of meiosis to living organisms? *
O genetic variation and growth
O growth and development
O development and sexual reproduction
O sexual reproduction and genetic variation

Answers

Answer:
Sexual Reproduction and genetic variation

Explanation:

Meiosis is important for three main reasons: it allows sexual reproduction of diploid organisms, it enables genetic diversity, and it aids the repair of genetic defects.

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

Michael loves playing his clarinet and believes it attracts more rabbits than any other instrument he
has played. In order to test his hypothesis, Michael played a song on his clarinet for a total of 5
minutes and counted the number of rabbits he saw in his front yard. He played the song a total of 3
times on his clarinet and repeated the experiment using a flute and a guitar. He also recorded the
number of rabbits he observed when he was not playing an instrument. The results are shown in the
chart.
Number of Rabbits
TRIAL
NO MUSIC
CLARINET
FLUTE
GUITAR
15
1
2
3
5
3
2
10
12
5
8
9
12
18
7
1) What is the independent variable?
2) What is the dependent variable?
3) What is the experimental group?
4) What is the control group?
5) What is one constant from the experiment above??

Answers

Answer:

Independent variable: type of instrument

Dependent variable: Number of rabbits attracted

Experimental group: The group when he played an instrument

Control group: The group when not playing an instrument

Constant: Same song

Explanation:

1. Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the variable that is changed is the TYPE OF INSTRUMENT used (clarinet, flute, guitar), hence, it is the independent variable.

2. Dependent variable is the variable that is measured in an experiment. It is the variable that responds to the changes made to the independent variable. In this experiment, the dependent variable is the "NUMBER OF RABBITS ATTRACTED" by the instrument played.

3. Experimental group is the group of an experiment that receives experiment treatment, which is the independent variable. In this case, the experimental group is the GROUP IN WHICH INSTRUMENT WAS PLAYED.

4. Control group is the group that does not receive the experimental treatment. In this case, the control group is the group in which INSTRUMENT WAS NOT PLAYED.

5. Constants are those variables that remains unchanged for all groups throughout the experiment. In this case, one constant is the SAME SONG played.

Question 14 (2 points)
(06.03 MC)
Which of the following correctly identifies a lymphatic organ and describes how it
can fight cancer? (2 points)
1) Lymph vessel; removes fluid from tissues
2) Lymph trunk; returns lymph to the blood
3) Spleen; replaces damaged red blood cells
4) Thymus; exposes lymphocytes to antigens

Answers

All of the statements correctly identify a lymphatic organ. In vertebrates, the lymphatic organs, also known as the lymphoid system, are an organ system that is a part of the immune system and works in conjunction with the circulatory system.

The Lymphatic OrgansLymphatic vessels, which are found all over your body and transport lymph away from tissues, are a network of capillaries (microvessels) and a huge network of tubes.By emptying into the corresponding subclavian veins, the lymph ducts, which are formed by the lymph trunks, restore lymph to circulation.Red blood cells that are outdated or damaged are eliminated by the spleen, which also removes cellular waste from circulation.Training specific white blood cells known as T-lymphocytes or T-cells is the thymus gland's main job.

Hence, all of the statements correctly identify a lymphatic organ.

How lymphatic system fights Cancer?Regional lymph nodes, which are predictive of distant organ metastases and poor survival, are accessible to tumor cells via lymphatic arteries.As the lymph fluid moves through the lymph nodes, it is filtered. B cells and T cells, two types of white blood cells, assault any viruses or bacteria they discover in the lymph.

To learn more about the Lymphatic System refer to:

https://brainly.com/question/13676212

#SPJ1

Other Questions
20% of 260 students at hill middle school ride a bus to school. how many students ride a bus to school? Find the Value of x and y. Iready find QR. help please and thank you n the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?50% water and 50% vinager100% water100% vinageror 25% vinager and 75% water Hello! I really need help! I am stumped on these analogies for a CLUE stems sheet. 11. Ergatocracy : gerontocracy :: a. Elderly : manual b. Hard hat : cane c. Fraternity : fraternal d. Eohippus : horse 12. Status quo : revolution :: a. Form : metamorphosis b. Taxidermy : animal c. Autotroph : heterotroph d. Vivisect : dissect 13. Phenomena : phenomenon :: a. Fraternize : fraternity b. Benevolent : benevolence c. Fungi : fungus d. Saprophyte : saprogenic Solve for xPlease Help! (can u guys help me PLSSSSS ) A company sets sales goals for employees each month. A: At her current pace, how many items will Kristina sell in 28 days?B:Is she on track to meet the goal? Explain What is the percent composition of Phosphorus in Li3PO3 10. One number is twenty more than eight times another number. The sum of thenumbers is eleven. Find the two numbers. The difference of n and 2 is 10 .What is (4x2-9X+1) -(5x2-x-7) written in standard form? Why did Hamilton argue for a strong federal government Who has legislative power? QRINC offered new employees a starting salary of $34,862 in 2013. What would a comparable starting salary have been in 2003? You have a stock solution of HNO3 with a concentration of 4.5 x 10^-4 M. However, you need 275 ml of a 2.50 x 10^-5 M solution. How much of the stock solution will you need? does anyone know a free app that i can watch shows on? what show u may ask it called the 100 The population of a city is 51,000 and is decreasing at a rate of 1.75% per year. Use an exponential function to find the expected population in 5 years. Round to the nearest whole number. Katie's baby took 3 naps. Each nap was of an hour long.6How long did the baby nap in all? Move numbers to the blanks to answer the question. plz help w these 5 problems. im begging anyone ! please please please . The bar graph shows the number of military deaths during the Civil War.huryyy plssssWhich statement accurately explains the cause of military deaths during the Civil War?More Confederates died from their wounds than Union soldiers.More Confederates died from disease than Union soldiers.Most soldiers on both sides died from their wounds rather than disease.Most soldiers on both sides died from disease rather than their wounds.