WILL GIVE BRAINLIEST!
4. How does an increase in the human population affect the use of natural resources? (1 point)

O An increase in the human population does not affect the use of natural resources,
O An increase in the human population means more natural resources will be used.
O An increase in the human population means that fewer natural resources will be used.
O An increase in the human population means that natural resources will be more stable.

Answers

Answer 1

Answer:

Number 2

Explanation:

The more people, the more resources that will need to be used. Hope this helps :)

Answer 2

Answer: B)An increase in the human population means more natural resources will be used.

Explanation: The more people there are on the planet, the more things people will need and therefore increasing the amount of resources used.


Related Questions

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

What number go in each circle ?
What number go in both circle?

Answers

Answer:

1 goes in the middle of all of the circles. 2 goes in animal cell. 3 goes in plant cell. 4 goes in between animal and plant cell. 5 goes in The middle of all of the circles. 6 goes in the middle of all of the circles. 7 goes in the bacteria circle. 8 goes in bacteria. 9 goes in bacteria.

Also:

8 and 9 I'm not completely sure of. Let me know if I'm wrong. Good Luck! :D

Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another

Answers

answer: yes

exanation:

plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion

Answers

I believe C- photosynthesis but I could be wrong.

1. what is an organelle?

2. give me an example of an organelle.

3. Which organelle is the "command center" of
the center?

Answers

Answer:

1. a subcellular structure that has a job to do within the cell

2. mitochondria

3. the nucleus

What is the series of processes in which a plant converts sunlight into a useful simple sugar called?

division

choloplasts

photosynthesis

mitosis

Answers

Answer: Photosynthesis

Explanation: I had this question to and it should be correct. I’m sorry if not.

Describe how the circulatory system allows the endocrine system to do its job?​

Answers

Answer:

The circulatory system is the transport system for endocrine info. The endocrine chemicals and hormones must circulate through the body via blood vessels.

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815


An air mass that originates over land in Central America is most likely

Answers

Answer:

An air mass that originates over land in Central America is most likely warm & dry.

Explanation:

Answer:

Warm and Dry

Explanation:

A P E X answer

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Which of the following IS NOT a part of the cell theory? *
All organisms are made of one or more cells
All cells contain nuclei and membrane bound organelles
Cells arise from pre-existing cells
Cells are the basic units of structure and function

Answers

Answer:

all cells contain nuclei.

Explanation:

prokaryotes dont have a nuclei

For each of the following nitrogenous base sequences, write the complimentary sequence on the line provided.
a) A – T – C – C – T – A – G – A – A – G – G – T __________
b) C – G – T – T – G – C – A – G – A – A – C – T __________
c) T – A – C – G – G – A – T – C – G – T – C – A __________

Answers

a) TAGGATCTTCCA
b)GCAACGTCTTGA
c)ATGCCTAGCAGT

How does soil erosion affect streams and rivers?

Answers

Explanation:

The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.

Hemoglobin is found in red blood cells and carries oxygen from your lungs to the rest of the body. Insulin is a hormone used to regulate blood sugar levels. Since hemoglobin and Insulin are made of chains of amino acids, they are examples of which type of organic molecule?

A. Lipid
B. Protein
C. Carbohydrate
D. Nucleic acid​

Answers

Answer:

B

Explanation:

Proteins are made of chains of amino acids.

Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore

Answers

Answer:

Decomposer

Explanation:

Decomposers eat dead organsims carnivores rarely

Answer:

C. Decomposer

Explanation:

A.P.E.X

6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia​

Answers

Answer:

Desert mole excretes concentrated urine with urea.

Marine fish excretes urine with uric acid.

Tilapia excretes dilute urine with amino acids.

Explanation:

The nitrogenous wastes that are excreted by the following organisms are as follows:

Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids.

What is Nitrogenous waste?

Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.

Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.

While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.

Therefore, it is well described above.

To learn more about Nitrogenous waste, refer to the link:

https://brainly.com/question/9517408

#SPJ2

What are two ways in which cells use the energy temporarily stored in ATP?

Answers

Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways

The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.

What is Active transport?

Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.

ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.

Learn more about ATP here:

https://brainly.com/question/14637256

#SPJ2

What three things regarding cell organelles are different between plant and animal cells?

Answers

Answer:

Plant cells have a cell wall, but animals cells do not. ...

Plant cells have chloroplasts, but animal cells do not. ...

Plant cells usually have one or more large vacuole(s), while animal cells have smaller vacuoles, if any are present

what is a cell membrane?

Answers

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.

Explanation:

Answer:

Short. The semipermeable membrane surrounding the cytoplasm of a cell.

Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

What are non- examples of an electromagnetic wave?

Answers

An electromagnetic wave can travel through anything - be it air, a solid material or vacuum. ... Examples of EM waves are radio waves, microwaves, infrared waves, X-rays, gamma rays, etc.

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

Give SOME EXAMPLES OF NATURAL CYCLE CHECKPOINTS .

Answers

Answer:

For example, delays in mitosis are often ascribed to 'activation' of the mitotic checkpoint, a descriptor that fails to recognize that the checkpoint by definition is active as the cell starts mitosis. Conversely, the completion of mitosis in the presence of misaligned chromosomes is often automatically interpreted to indicate a defective checkpoint, even though in the absence of critical testing alternative interpretations are equally likely. In this article, we define the critical characteristics of checkpoints and illustrate how confusion generated by the inconsistent use of terminology may impede progress by fostering claims that mean very different things to different researchers. We will illustrate our points with examples from the checkpoint that controls progression through mitosis

Explanation:

Answer:

Below

Explanation:

G1 checkpoint, also known as the Start or restriction checkpoint or Major Checkpoint; the G2/M checkpoint; and the metaphase-to-anaphase transition, also known as the spindle checkpoint.

Pls I need badly help

Answers

Answer:

medusa

Explanation:

Which is an example of the use of plants in human societs?

Answers

Answer:

|

v

Explanation:

photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.

Human uses of plants include both practical uses, such as for food, clothing, and medicine, and symbolic uses, such as in art, mythology and literature.

Question 4 of 10
Which of the following best describes cost-benefit analysis?

Answers

Answer: a) a process of maximizing benefits and minimizing costs. b)a way to predict how much someone will earn in the future. c)a calculation of how much profit will result from a certain level of spending. d)a method of calculating money spent on a project.

Explanation:

describe and explain how the rate of photosynthesis is affected by light intensity​

Answers

Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply. At very high light intensities, photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

A group of students studied heat transfer by placing a hot block of metal into a Styrofoam cup of room temperature water what method of heat transfer with the student studying

Radiation

Convection

Conduction

Thermal energy

Answers

Answer: Thermal Energy

Explanation:

i worked it out tell me if im right

Method of heat transfer which is  being studied by the student is thermal energy.

What is thermal energy?

Thermal energy is defined as a type of energy which is contained within a system which is responsible for temperature rise.Heat is a type of thermal energy.It is concerned with the first law of thermodynamics.

Thermal energy arises from friction and drag.It includes the internal energy or enthalpy of a body of matter and radiation.It is related to internal energy and heat .It arises when a substance whose molecules or atoms are vibrating faster.

These vibrating molecules and atoms collide and as a result of which heat is generated in a substance , more the collision of particles , higher is the thermal energy. There are 3 types of thermal energy 1) conduction 2)  convection 3) radiation

Learn more about  thermal energy,here:

https://brainly.com/question/11278589

#SPJ2

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water

PLEASE ANSWER!! The city council of Jacksonville, Montana, is considering turning some of its grassy areas into large ponds. Farmers have argued against this idea because they are concerned that taking away too much of the grassy areas will hurt the sheep. Write a claim to counter the farmers’ argument, using the data above. Make sure to include a rebuttal in your answer.

Answers

Answer:

As the city council of Jacksonville, Montana is thinking of turning grassy areas into large ponds which is not acceptable by the farmers because they are concerned it will affect the sheep population. Farmers are right because grassy areas form a habitat for the sheep population in that area and make a balance between predators and prey.

As we can see the data of the relationship between predators and prey, growth in grassy areas in years maintains a balance of predators and prey where wolfs are not harming many sheep but if grassy areas will be detroyed, it will be easy for wolfs to dominate sheep population.

Other Questions
Answer each question.7. Quin eres?8. Son inteligentes los alumnos?9. Son ustedes alumnos en una escuela grande o pequea?10. Quin es el/la profesor(a) de espaol? Read the excerpt from Crossing Brooklyn Ferry.Just as you feel when you look at the river and sky, so I felt,Just as any of you is one of a living crowd, I was one of a crowd,Just as you are refreshed by the gladness of the river and thebright flow, I was refreshed,Just as you stand and lean on the rail, yet hurry with the swiftcurrent, I stood yet was hurried,Just as you look on the numberless masts of ships and thethick-stemmed pipes of steamboats, I looked.How is this excerpt representative of free verse?A.The poet is expressing ideas through a loose structure with repetition.B.The poet is expressing ideas using a strict structure with rhyme.C.The poet is expressing ideas using repetition and a specific rhythm.D.The poet is expressing ideas without any structural elements. ATP is to your cells as ______ is to a car Need help ASAP please help me please How can you drop two eggs the fewest amount of times, without them breaking? What is an ally?A required contribution to the government or added to the cost of some goodsCash or liquid assets held or obtained for expendituresa country formally helping another country for a military or other purposematerial prosperity can anyone help answer all these questions Li deposited $17,500 into a bank account that earned simple interest each year. After 2 years, he had earned $2975 in interest.No money was deposited into or withdrawn from the account.What was the annual interest rate?Enter your answer in the box. what motif is present in both the myth and the modern story? Select the correct answer from each drop-down menu.Early animation saw the use of many techniques that are seen even today. What techniques can be seen in the early animations of Windsor McCay?Windsor McCay first used____ in the film Little Nemo. This made animated motion more realistic. His second film, Gertie the Dinosaur, made use of the ______ techniques. 2. DETERMINE THE TEMPERATURE ATWHICH NIO GRAMS OF POTASSIUMNITRATE DISSOLVE IN 100 GRAMS OFWATER A boy who is 3 feet tall can cast a shadow on the ground that is 7 feetlong. How tall is a man who can cast a shadow that is 14 feet long? 15 POINTS Which type of government has a powerful central government that does notallow smaller local governments to exercise much power or independence?A. UnitaryB. ParliamentaryC. FederalD. Confederal Which expression is equal to 8s 2s2 + 23s 4? of this data set 56, 57, 57, 58, 59, 60, 60, 60, 62, 64, 64, 66, 67, 67, 67, 68 what's the mean absolute deviation The number that represent the parts per 100 is called the part In 2-3 sentences, identify and describe one of the conflicts happening in The Odyssey so far. Think of the issues that keep arising inthe story and explain this problem and its developement through the text so far. Think about what situation in society favors the emergence of totalitarianism? (ie what social events lead to the people wanting to overthrow democracy and kneel to totalitarian authorities?) Think about what, in your opinion, would be a "cure" against the emergence of totalitarianism in our society and time? Which of the following is a form of government, not a government system? A. unitary B. federal C. oligarchy D. confederate Need Help with this!