Which of the following is not considered a living thing?
a. soil
b. oak trees
c. sharks
d. pandas

Answers

Answer 1
the answer would be soil the other person is wrong please give me branliest(:

Related Questions

Based on the graph in Figure 2, identify the environmental conditions (flower density AND proportion of deep flowers) where a short- tongued bee has the greatest relative advantage over a long tongued bee. Based on the graph in Figure 2, identify the range of proportion of deep flowers at which a long tongued- bee always has an advantage over a short tongued bee.

Answers

Answer:

The correct answer would be - low flower density and low deep flower proportion

Explanation:

To find the environmental conditions for a short-tongued bee has the greatest relative advantage over long-tongued bees it is required to find the highest value of relative advantage short-tongued bees has on long-tongued bees which is the point where flower density and deep flower proportion is lowest (near the zero) according to the graph. That is represented in the graph by the peak in the white shaded portion.

To find the range of deep flower proportion at which a long-tongued bee has an advantage take a closer look to the grey shaded area where if the deep flower proportion move from 0.6 to 1 the advantage of long-tongued bees over short-tongued.

Floral density with the graph shows the low flower density and low deep flower proportion. Floral density often influences the species composition of flower visitors.

This variation in visitor species composition has significant effects on pollination success and plant fitness, poorly understood, especially in the many pollination guilds dominated by non-territorial species.

How do flower visitors diverse the traits?

It explores how flower visitors with diverse traits should distribute themselves across resource patches differing in floral density.

The model predicts that species with low flower search speeds and low flower handling costs compared to competitors will usually dominate dense flower patches.

In addition, amongst flower visitors that have lower energy expenditure rates while handling flowers than while traveling, species maximizing energetic efficiency are associated with dense flower patches.

Therefore, the correct answer is low flower density and low deep flower proportion.

Learn more about the flower density here:

https://brainly.com/question/11253692

I need help with number 3​

Answers

O2 (oxygen) is a covalent compound

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

Tay-Sachs disease is a rare inherited disorder that progressively destroys nerve cells
in the brain and spinal cord. The allele for having Tay-Sachs is recessive written as t
and the functional allele is written as T. If two heterozygous parents have four
children, how many of the offspring will most likely inherit and develop Tay-Sachs
disease?

Answers

Answer:

B and C

Explanation:

I just took the test and it was right

someone pleaseee help me with this !!

Answers

lizards and snakes!

in which direction do particles in a solution move during passive transport

Answers

During the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending. The passive transport is seen in the cell too.

What is the importance of the different types of transportation?

In the cell, different types of transport are seen, such as active transport and passive transport; in active transport, energy is used, while energy is not used in passive transport. The movement of molecules across the cell plasma membrane is important because it allows cells to get rid of unwanted molecules. Passive transport does not require energy, and many nonpolar small molecules and gases can cross the lipid plasma membrane barrier and go into and out of the cell while, in this passive transport process, they save the cell's energy.

Hence, during the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending.

Learn more about the different types of transportation here.

https://brainly.com/question/29764225

#SPJ6

20 points and brainliest!
More and more often, farmers and food manufacturers are genetically modifying crops to improve flavor, reduce disease, and lower costs. Do you think genetically modifying food is a good idea? Use specific examples and reasons to support your opinion.

Answers

Explanation:

it is a good idea as it increase the life of certain food, also keeps bacteria away

Can you give me a slogan for using compost at home

Answers

Answer:

Mark my answer the brainliest if this helps,

A Partner with the Environment.

Because What You’ve Got is Not Waste.

Clean Up Your Act. Compost.

Compost On Your Mind?

Don’t Burn Our Future.

Eat Smart

Enriching the Soil Naturally.

Feed the Soil.

Fit Energy Saving Light Bulbs

Give Green a Chance

Greening the Hill.

It’s Easy to Do.

Lets Talk Dirty.

Local Composting Made Easy.

Making a Clean Scene.

Making a Compost Pile

Mother Nature Recycles.

Nature’s Way to Grow.

Plant a Garden

Plant Trees

Raking Leaves

Recycle All Recyclable Items

Recycle Your Grey Water

Reduce The Use of Energy

Replenish the Earth for Generations.

Reuse Stuff

Reuse Whatever You Can

Reuse, Reduce and Recycle

Save Water To Save Money

Shoveling The Driveway

Smells Like Green Spirit

So Hot Right Now.

Sustainability Stools.

The Compost People.

The Solution to Sustainable Soil and Water.

Think Before You Buy

Too Good to Waste.

Turn It Off When Not In Use

Use Less Electricity

Walk To Work or Take The Bus

Waste Wise.

We Speak Organic.

We’re Growing.

Zero Waste.

Answer:

mark ssydnie the brainliest

Explanation:

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

According to Chargaff's rule of base pairing, which of the following is true about DNA?
O A=G and C=T
O A=T and C=G
O A=T=G=C
O A=C and G=T

Answers

Answer:

a = t and c = g

Explanation:

just took the test, hope this helps <3

brainliest pls? :)

The Char gaff rule is all about the number of adenine is equal to the number of thymine and with that the number of cytosine is equal to the number of guanine. The correct answer is option B.

What are the types of bonds that are present in between these nitrogenous bases ?

The kind of bonds that are present in these  nitrogenous bases are hydrogen bonds. A binds with T with two hydrogen bonds and C binds with G through 3 hydrogen bonds.

It is all about that the number of purines is equal to the number of pyrimidines. The number of adenine molecule are present totally in equivalence to the number of thymine molecules.

The number of guanine molecules are present in the molecule of DNA are totally in numbers to the cytosine. In place of thymine uracil is present which is present in RNA.

Learn more about DNA at :

https://brainly.com/question/14315652

#SPJ2

Which of the following is an example of how a species may change over time?
A.
Bacteria become resistant to antibiotics.
B.
Dog fur becomes thicker in the winter.
C.
Turtles become male or female based on incubation temperature.
D.
Humans become immune to a certain illness after vaccination.

Answers

Answer: possibly A

Explanation: B an C are not it because they are more like mutations. D humans don’t always become immune.

When discussing Newton’s laws of motion, which terms do people most likely use when talking about Newton’s third law of motion?

A. “action” and “reaction”


B. “mass” and “inertia”


C. “inertia” and “force”


D. “force” and “acceleration”

Answers

Answer:

A. action and reaction

Explanation:

the third law is:-

Every Action has it's opposite and equal Reaction

Answer:

The correct answer is "action" and "reaction".

Explanation:

Newton's Third Law is: "for every action, there is an equal and opposite reaction". This means that every time something is pushed on, the other object pushes back. For example, when a swimmer pushes off the wall of a pool, the wall will push back on the swimmer, giving them the push they need to swim to the other side.

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

Adhesion occurs when water is attracted to other polar substances. Which of the following is an example of adhesion in organisms?
a. Capillary action of liquid in plant stems b. Release of sweat to reduce body heat
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system​

Answers

Answer:

a. Capillary action of liquid in plant stems

C. Movement of ions to maintain homeostasis

d. Pumping of blood through the circulatory system​

Explanation:

Hope this helped!

In organisms, an important example of adhesion is the: a. Capillary action of liquid in plant stems.

What is Adhesion?

Adhesion can be described as the attraction that occurs between molecules as a result of molecular mechanism, which is also known as capillary action.

In plants, capillary action occurs when the molecules of water cling to the xylem cell walls. This is known as adhesion.

Therefore, an example of adhesion in organisms is: a. Capillary action of liquid in plant stems.

Learn more about adhesion on:

https://brainly.com/question/14457491

#SPJ2

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

What do RNAs do in the cell?

Group of answer choices

Answers

Answer:

A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.

Explanation:

None

This stuff annoying!!!!!!!!!!!!!!!!!!!!

Answers

wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink  wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink

can u answer that question

Answers

Answer:

The synthesis of new proteins

6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia​

Answers

Answer:

Desert mole excretes concentrated urine with urea.

Marine fish excretes urine with uric acid.

Tilapia excretes dilute urine with amino acids.

Explanation:

The nitrogenous wastes that are excreted by the following organisms are as follows:

Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids.

What is Nitrogenous waste?

Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.

Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.

While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.

Therefore, it is well described above.

To learn more about Nitrogenous waste, refer to the link:

https://brainly.com/question/9517408

#SPJ2

"CRISPR" stands for Clustered Regularly Interspaced Short Palindromic Repeats, which are the hallmark of a bacterial defense system that forms the basis for CRISPR-Cas9 genome editing technology. In the field of genome engineering, the term "CRISPR" or "CRISPR-Cas9" is often used loosely to refer to the various CRISPR-Cas9 and -CPF1, (and other) systems that can be programmed to target specific stretches of genetic code and to edit DNA at precise locations, as well as for other purposes, such as for new diagnostic tools. How can this tool be used to alter genes in various organisms?

Answers

Answer:

by designing short guide RNAs (sgRNAs) customized to target genes of interest in the cells of these species

Explanation:

The CRISPR-Cas9 editing system is a versatile and powerful genome engineering tool for editing genomes, which can be directed to alter almost any DNA sequence in order to modify gene function. This system consists of an endonuclease protein (Cas 9) that cuts DNA at specific sites guided by a short guide RNA (sgRNA), which binds by base complementarity to the target sequence. This sgRNA must be designed with efficiency and specificity to target genes of interest. In consequence, the CRISPR-Cas9 genome editing system produces DNA double-strand breaks which may be repaired by 1- error-prone nonhomologous end joining (NHEJ) or 2-homology-directed repair (HDR) DNA repair pathways. According to the DNA repair pathway that has been activated, it is possible to trigger genetic modifications in the cells of different species (i.e., plant cells, animal cells, human cells, etc).

What structure is responsible for the suction created by the
starfish's tube feet?

Answers

I believe it’s A or the first answer. Hope this helps :)

What is a likely reason for the change from mitosis to meiosis during reproduction under these conditions?

Answers

it’s b, meiosis is mixing both parent cells genetic information therefore their offspring have a better chance at sieving

Mitosis and meiosis are the two types of cell division, which result in the generation of daughter cells. Yeasts are capable of undergoing meiotic and mitotic division under favorable conditions.

The correct answer is:

Option B: Crossing over genes during meiosis increases diversity and the chance of survival of the next generation.

The significance of meiosis can be explained as:

Meiosis is a reduction division, in which the diploid parent cell gives rise to haploid daughter cells.

The crossing over of the genetic material of the haploid cells leads to genetic diversity and a higher rate of survival.

Meiosis leads to genetic diversity as the data in the parent cells are fused and recombined to give rise to new offspring.

Thus, meiosis is an important step in the genetic variation and survival of the organism.

Therefore, option B is correct.

To know more about meiosis, refer to the following link:

https://brainly.com/question/11622266

5 tips to improve your critical thinking - Samantha Agoos

Watch the Video and make a summary

Ps: They don't let me paste the link lookup what it says above

Answers

Answer:

that one is hard because we did not see the vidoe

Explanation:

What is a strength in the figure?



The figure shows structures in a cell.

The figure shows stem cell differentiation.

The figure shows where mitosis occurs in the cell cycle.

The figure shows DNA replication.

Answers

Answer:

The figure shows where mitosis occurs in the cell cycle. after the interphase

Explanation:

The figure explains where mitosis occurs in the cell cycle, which is present in the third option. The cell cycle is depicted in the diagram, in which different stages are present, such as from the growth stage to the division phase.

What is the role of the cell cycle?

The cell cycle is important for cell growth and division, such as the formation of gametes, the cell's growth from its original size to a larger one, the growth of body's size, and so on. The first phase of the cell cycle is the G1 phase, where the cell grows in size, and later in the S phase, DNA replication takes place. In the given image, the cell cycle is depicted with all of these stages, and after the S phase, the G2 phase takes place, and then mitosis takes place in the M phase.

Hence, the figure explains where mitosis occurs in the cell cycle, which is present in the third option.

Learn more about the cell cycle here.

https://brainly.com/question/25282664

#SPJ2

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

PLEASE HELP ME!!!


3) Describe a eukaryotic cell. Your description should include where you would expect to
find these types of cells.

4)Describe a prokaryotic cell. Your description should include where you would expect to
find these types of cells.

Answers

3)Eukaryotic cells have membrane-bound organelles. They have a nucleus. They are usually found in animals and plants. In all multicellular organisms and some unicellular(amoeba)

4)Prokaryotic cells don't have a nucleus. They don't contain membrane-bound organelles they only contain ribosomes.They are much smaller. Bacteria are prokaryotes.

centricles play specific roles during the division of​

Answers

Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them

Explanation:

HELP ME PLSSS someone

Answers

Answer: B

Explanation: The amount of salt in the inner circle is equal to the amount of salt in the outer circle.
Other Questions
Describe what happened with the knocker on the door of Scrooge's house. how do you find the slope intercept on a graph? fine the slope of the line that passes through the points (2,4) and (3,-2) Someone please help!!! Anyone!?!? I'll give A Brainliest The diagram shows a food web in a grassland.What best describes the role of the grasshopper in the food web?Group of answer choicesA primary consumer that is food for the lizard and hawkA secondary consumer that is food for the lizard and hawkA primary consumer that is food for a single predator, the lizardA secondary consumer that is food for a single predator, the lizard Ill give 500 points to whoever solves this asap. Identify the sentence that correctly uses an ellipsis.A)"His.. to cooperate with the police and name the culprit resulted in hisarrest."B)"His refusal to cooperate with the police and name the culprit...resultedin his arrest."C"His refusal to cooperate with the police and name the culprit...resultedin his arrest..."D)"... refusal to cooperate with the police and name the culprit...resulted inhis arrest.... Irene can snap 48 times in 8 minutes at a constant rate. How manytimes can she snap in 9 minutes? A washer and dryer cost $906 combined. The washer cost $56 more then the dryer. What is the cost of the dryer ? PLZ HELP MEEEE!Read the paragraph.Seeing Marta roller skate for the first time was like watching a newborn horse try to walk. After a wobbly start, she actually began to roll smoothly down the sidewalk. Suddenly though, it seemed that something scared her, or maybe she just became too confident. Each foot seemed to slide out from under her in opposite directions. She flailed her arms about wildly before landing on her side. When she tried to get up again, her feet kept shooting out from underneath her. To her credit, she kept trying!What is the meaning of the simile in the paragraph? 1. Martas skating is very awkward. 2. It is painful to watch Marta skating. 3. Skating comes naturally to Marta. 4. Martas skating improves quickly. Each of the 25 students in Mr. McDonalds class sold 16 raffle tickets. If each ticket costs $15, how much money did Mr. McDonalds students raise? pls help asap!Based on paragraph 23, what can the reader conclude about Jolanda?A. She will attempt to guess what the narrator is thinking.B. She will learn how to read minds to impress the narrator.C. She believes she will become good friends with the narratorD. She believes she will be able to anticipate the narrators actions. You like my koala his name is Fred What did Lizzie do when she putone foot forward"? In a few sentences, describe how sedimentary rock forms. what number is 386 more than the sum of 345 and 425 The sale price of every item in a store is 85% of its usual price. The usual price of a backpack is $30, what is its sale price? The usual price of a sweatshirt is $18, what is its sale price? The usual price of a soccer ball is $24.80, what is its sale price? What can you tell about the elements from the way they are ordered in the table? dishwashers. How many of each type should Sparkle Clean produce to fulfill the order AND minimize their production cost Why was Ovids writing significant? Which graph represents a proportional relationship