Which is most likely the first step in a basic food chain? ​

Answers

Answer 1

autotrophic plants

This is the answer

Answer 2
producers use the energy from the sun to create their own food :)

Related Questions

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

Make a list of different weather patterns

Answers

Weather comes in all different forms, and it changes by the day. It could be sunny one day and raining the next. It could even be sunny, rainy, cloudy, and stormy in one day.

Common Types of Weather Elements

The weather has a lot of different factors. When someone asks how the weather is today, you need to think about temperature, humidity, precipitation, wind, cloudiness, and atmospheric pressure. All these different parts work together to create the weather you see when you walk out the door.

Which of the following does not contribute to erosion?
O Lava
Olce
O Wind
O Water

Answers

Lava..

got it right on edge 2020

The carbon cycle is based on CO2. Therefore, photosynthesis is the opposite of

A
cellular respiration.

B
reproductive cycle.

C
nitrogen cycle.

D
biochemical processes.

Answers

Answer:

A Cellular Respiration

Explanation:

This is because Photosynthesis takes CO2 and pushes our Oxygen, while the inverse is true for cellular respiration.

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

Phenotypes are the
observable characteristics of an individual (ex:
curly hair)

or

genetic representation of a an individual (ex: Hh)

Answers

Answer:

phenotype are the observable characteristics of an individual (ex:curly hair)

Please explain what osmosis is?

Answers

movement of a solvent (such as water) through a semipermeable membrane (as of a living cell) into a solution of higher solute concentration that tends to equalize the concentrations of solute on the two sides of the membrane.

(hope this helped)

Answer:

osmosis is a special type of diffusion that is the movement of WATER particles from an area of high concentration to and area of low concentration across a semi-permeable membrane

Explanation:

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

What Bacteria is put in yougurt ?

Answers

two species of bacteria called Lactobacillus bulgaricus and Streptococcus thermophilus.

Answer:

food bateria

Explanation:

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

has anyone done this worksheet? i need help with it. thanks:)

Answers

I have done it I think
try scanning it with the google app with text and usually answer keys pop up good luck!

Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of over million base pairs. Approximately how many genes are found on chromosome 17? List the genetic disorders found on chromosome 17. What do you know about any of those disorders?

Answers

Answer:

Hello!

Chromosome 17 is made of over 80 million base pairs.

Approximately how many genes are found on chromosome 17? 1600

Explanation:

Chromosome 17 is made up of more than 80 million base pairs. Approximately, 1600 genes are found on chromosome 17. The genetic disorders found on chromosome 17 are as follows:

Breast cancer.Neurofibromatosis.DNA damage response in individuals.Scoliosis.Congenital heart anomalies.

What are Chromosomes?

Chromosomes may be defined as thin, thread-like structures that may appear in the nucleus of the cell during the process of cell division. These structures may contain DNA, RNA, histones, and non-histone proteins. Chromosomes may be discovered by E. Strasburger in 1875.

Human chromosome 17 is implicated in a wide range of human genetic diseases. It is home to genes involved in many genetic disorders that may affect the physiology of an individual. They are very severe to organisms.

Mosaic trisomy 17 is a rare chromosomal anomaly syndrome, with a highly variable clinical presentation, mostly characterized by growth delay, intellectual disability, body asymmetry with leg length differentiation, scoliosis, and congenital heart anomalies.

To learn more about Genes and chromosomes, refer to the link:

https://brainly.com/question/29393001

#SPJ2

Plant cells are classified as

pluripotent
omnipotent
multipotent
totipotent

Answers

Answer:

pluripotent i think sorry if I'm wrong

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

What would happen to a species if it was quickly moved from a familiar environment to an extremely different environment.

Answers

Depending on how good that species is at adapting to new environments that species of animals could adapt overtime, or die

Bacteria cannot survive in deep ocean areas where no light is present. true or false

Answers

Answer:

false on edge

Explanation:

People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis

Answers

Answer:

C. have medical insurance

Explanation:

People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.

The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.

What is the diagnosis?

The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.

Thus it is well explained.

To learn more about the medical insurance refer to link :

https://brainly.com/question/1941778

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

What is the electrical charge of the nucleus of an atom that has 11 protons , 12 neutrons , and 11 electrons ?

Answers

Answer:

The 11 positive protons cancel out the 11 negative electrons, and the overall charge of the atom is zero. So it neutral

Explanation:

I hope this helps!!

The nucleus of an atom has only protons and neutrons. Since the neutrons are neutral, the charge on the nucleus, in this case, would be +11.

What is the atomic charge?

The difference between the number of electrons and protons in an atom is defined as the charge on that particular atom. An atom has three sub-atomic components. These are electrons, protons and neutrons.

The electrons are negatively charged, the protons are positively charged and the neutrons are neutral.

Because the neutrons are neutral, the increase or decrease in the number of electrons or protons affects the charge on an atom. If the number of protons is higher, the atom will be positively charged. If the number of electrons is higher, the atom will be negatively charged.

The protons and neutrons are present in the nucleus of an atom and the electrons are present in atomic shells.

Therefore, in a nucleus with 11 protons, and 12 neutrons, the charge will be +11

Read more about atomic charge, here https://brainly.com/question/5308494

#SPJ6

Compare asexual and sexual reproduction. Place each statement into the correct box.

Answers

Answer:

Explanation:

asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female

Answer:

During asexual reproduction, the organism that is reproducing spits in two.

A sea anemone reproduces asexually.

During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.

Humans reproduce sexually.

Explanation:

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

compare the chemical equations for photosynthesis and cellular respiration explain how the two processes are interrelated

Answers

Answer: Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water

Explanation:

Other Questions
Why do men exist ;-; explain the difference between operating forces and the short establishment HURRY!!!Urbanization can best be described by which of the following statements?A. The tendency for cities to develop large suburbsB. The decline of the inner city as residents move to the suburbsC. Adding green spaces to rural areasD. The growth of cities caused by the migration of people from rural areas to the cities Please help ill mark branliest (im using the last of my points for this so please don't scam me)can someone write about genetically modified foods and the genetic modification process? Help me please,,,,,,, thanks, gracias what is the y-intercept of a line that has a slope of -3 and passes through point (0,-7)A -7B -3C 0D 4 how does atomic radius affect coulombic attraction? What is the order for this?need help ASAP thanks same question again. ugh 30. Among the areas of the female genital tract, which of the following is NEVERinfected with Neisseria gonorrheae?A. vaginaB. cervixC. uterusD. fallopian tubes Amy said 49 of her teammates got hits during a recent softball game. Which decimal represents this same amount?A.0.49B.0.444C.0.444D.0.49 what is 3 1/4 as an improper fraction a imprper fraction? Compared to The Three Fates of Greek mythology, how does including Esperanza's character transform the theme of"The Three Sisters"? 2 1/6 divided by 1 1/4100 points which shape has sides that are straight and connected? Another easy Christmas question!Who is Rudolph, and why was he bullied? how is you day are you ok are you sad mad or happy Where should sinks be available for food serviceworkers?Outside the food preparation sinkSeparate sink located in the food preparationarea.Inside the customer bathroomaIn the employee breakroom Stefan sells Jin a bicycle for $116 and a helmet for $16. The total cost for Jin is 110% of what Stefan spent originally to buy the bike and helmet. How much did Stefan spend originally? How much money did he make by selling the bicycle and helmet to Jin? PLS HELP!!!!!!?? 21 pointsf(x)=x2. what is g(x)?A.g(x)=(9x)2B.g(x)=(1/3x)2C.g(x)=(3x)2D. g(x)=3x2