Which circuit hook-up design will have the brightest light bulb?A - 1 battery 1 bulb, B - 2 batteries 1 bulb, C - 3 batteries one bulb, D 2 batteries the bulb is on the other end, E 1 battery and 1 bulb on the other end

Question 5 options:

A


B


C


D


E

Heres another for you guys!

Which Circuit Hook-up Design Will Have The Brightest Light Bulb?A - 1 Battery 1 Bulb, B - 2 Batteries

Answers

Answer 1

Answer:

I believe it is E because the battery has a wire, a power source(the battery), and a bulb connected together thus making a full series circuit. Furthermore, the more batteries they are to a series circuit, the more dimmer the light bulbs will be.


Related Questions

What is an example of an initiation phase for an addition
polymerization reaction?
SELECT AN ANSWER
H-O* + CH3-CH3 ----> H-O-CH2-CH2*
H-O* + CH3-CH3 ----> H-O-CH2-CH2-O-H
H-O* + CH2=CH * ----> CH3CH2*
H-O* + CH2=CH2 ----> H-O-CH2-CH2*

Answers

Answer:

H-O* + CH3-CH3 ----> H-O-CH2-CH2*

H-O* + CH[tex]_3[/tex]-CH[tex]_3[/tex] → H-O-CH[tex]_2[/tex]-CH[tex]_2[/tex]* is an example of an initiation phase for an addition polymerization reaction. Therefore, the correct option is option A.

What is polymerization reaction?

High-molecular-weight compounds known as polymers are created by the aggregation of several smaller molecules known as monomers. Polymers make up the natural and manmade fibres used in clothes as well as the polymers that have revolutionised society.

Two fundamental methods for creating polymers exist: (a) joining small molecules together by an addition reaction, and (b) joining molecules while getting rid of a stable small molecule like water. Condensation processes, which combine addition and elimination reactions, are what this later type of polymerization is known as. H-O* + CH[tex]_3[/tex]-CH[tex]_3[/tex] → H-O-CH[tex]_2[/tex]-CH[tex]_2[/tex]* is an example of an initiation phase for an addition polymerization reaction.

Therefore, the correct option is option A.

To know more about polymerization reaction, here:

https://brainly.com/question/3775111

#SPJ7

How many oxygen atoms are contained in a sample of aluminum nitrate, Al(NO3)3, with a
mass of 4.285 x 10-21 g? (molar mass of Al(NO3)3 is 213 g mol-l)
a 109
b. 54
c. 9
d. 3

Answers

the answer is 9

Explanation:

Explanation: In 1 formula unit of Al(NO3)3 , there are (clearly!) 9 atoms of oxygen, 3 nitrogen atoms, and 1 aluminum atom.


Calculate the number of atoms in 3.21 mole of Mg?

Answers

Answer:

1.93 × 10²⁴ atoms

Explanation:

The number of atoms in a substance can be found by using the formula

N = n × L

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

From the question we have

N = 3.21 × 6.02 × 10²³

We have the final answer as

1.93 × 10²⁴ atoms

Hope this helps you

6
Which subatomic particle can be found revolving around the nucleus?
proton
neutron
electron

Answers

Answer : The correct option is, electron.

Explanation :

As we know that,

An atom is the smallest unit of a matter that consist of three subatomic particles which are electrons, protons and neutrons.

The protons and the neutrons are located inside the nucleus or the center of the nucleus where the mass of the an atom is concentrated.

The electrons are located around the nucleus.

The protons are positively charged, the electrons are negatively charged and the neutrons are neutral that means it has no charge.

According to the question, the electron subatomic particle found revolving around the nucleus.

Hence, the correct option is electron.

During ____, the chromatin condenses to make ____.
prophase, chromosomes
metaphase, chromosomes
prophase, DNA
metaphase, DNA

Answers

prophase, chromosomes

2.1 x 10^-3 x 2 x 10^2 =


a)
4.2 x 10^-5

b)
4.2 x 10^-1

c)
4.2 x 10^1

d)
4.2 x 10^-6

Answers

Answer:

I believe it is B

Explanation:

hope it helps. please let me know if it's wrong

(sand) and (Sand with water) both of them are heterogeneous
mixture isn't it?​

Answers

Answer:

yes true

Explanation:

both are heterogeneous

hi...need help....thank you..

Answers

Answer:

36 oxygen atoms

Explanation:

From the question given above, the following data were obtained:

Compound => 4Al₂(CO₃)₃

Number of Oxygen atom in the compound =?

The number of oxygen atom in the above compound can be obtained as follow:

4Al₂(CO₃)₃

Al = 4 × 2 = 8 atoms

C = 4 × 3 × 1 = 12 atoms

O = 4 × 3 × 3 = 36 atoms

From the simple illustration made above, there are 36 oxygen atoms in the compound.

Which of the following is a device that
breaks down light into colors and
produces an image of the spectrum,
which can help determine the chemical
composition of a star?
A. barometer
B. phonograph
C. spectograph
D. altimeter

Answers

The right answer is C.
The correct answer is C

1.What element is located at period 3, group 13?

2.Element at group 4, period 5?

Answers

Question 1 is boron
And question 2 is Vanadium
1.) Boron and 2.) vanadium

Identify the chemical reaction Below:
Ca(OH)2 + HCI CaCl2 + H20

Answers

Answer:

Neutralizaion reaction!

Explanation:

Calciumhydroxide under Hydrochloric acid gives Calciumchloride with the formation of water.

Convert 4.5 x 10-3 to standard Notation
Posted today at 6:30 am
1
=

Answers

Answer:

0.0045

Explanation:

Scientific notation is the way to express the large value in short form.

The number in scientific notation have two parts.

The digits (decimal point will place after first digit)

× 10 ( the power which put the decimal point where it should be)

for example 4.5×10⁻³

In standard notation

4.5 / 10³

0.0045

The expanded notation is standard notation of writing the numerical values which is normal way. The numbers are written as they are, without the power of 10.

what are some similarities between polar and nonpolar molecules

Answers

Answer:

Explanation:

Polar bonds also often contribute to a net dipole moment of a molecule. This basically means that there are partial charges that make a molecule overall polar. One example might be water: in H20, oxygen is very electronegative, and hydrogen is less so. This means that oxygen is more negative and hydrogen is more positive. This is why water is cohesive (can stick together): The positive ends stick to the negative ends.

To solve this we must be knowing each and every concept related to polar molecule.  Therefore, polar and nonpolar molecules are covalent compound.

What is polar molecule?

A polar molecule is a type of chemical compound where there is an uneven distribution of electrons among the covalently bound atoms.

The term "polarity" refers to how unlike two molecules' electrical poles are from one another. If they are quite dissimilar, the species is said to be an extremely polar molecule.

Because of the more symmetrical distribution of the electrons, non-polar molecules do not have a lot of charges on their opposing sides. The fees are all offset by one another. Polar and nonpolar molecules are covalent compound.

Therefore, polar and nonpolar molecules are covalent compound.

To learn more about polar molecule, here:

https://brainly.com/question/15173422

#SPJ2

When you drop things into bodies of water, some things sink and some things float. What determines this?

Answers

Answer: how dense the object is and if it has air in it.

Explanation:

Answer:

Density determines the situation.

The denser the body than water, it sinks in water

The less dense the body than water, it floats on water.

what percent of the sun's energy is used by the living organism on earth
a. 1%
b. 10%
c. 20%
d. 35%
e. 50%

Answers

1%. I figured it out by looking it up i dum

Answer:

1%  A

Explanation:

WILL GIVE BRAINIEST is C6H1005 + O2 → CO2 + H2O balanced?

Answers

Answer:

No! The balanced equation is given below:

C₆H₁₀O₅ + 6O₂ —> 6CO₂ + 5H₂O

Explanation:

C₆H₁₀O₅ + O₂ —> CO₂ + H₂O

The equation above is not balanced. It can be balance as illustrated below:

C₆H₁₀O₅ + O₂ —> CO₂ + H₂O

There are 6 atoms of C on the left side and 1 at the right side. It can be balance by 6 in front of CO₂ as illustrated below:

C₆H₁₀O₅ + O₂ —> 6CO₂ + H₂O

There are 10 atoms of H on the left side and 2 atoms on right side. It can be balance by 5 in front of H₂O as illustrated below:

C₆H₁₀O₅ + O₂ —> 6CO₂ + 5H₂O

There are a total of 7 atoms of O on the left side and a total of 17 atoms on the right side. It can be balance by 6 in front of O₂ as illustrated below:

C₆H₁₀O₅ + 6O₂ —> 6CO₂ + 5H₂O

Now, the equation is balanced.

Look at the picture. If one of the lightbulbs breaks or is removed, what will happen to the other lightbulb?

2 bulbs and a battery in a single loop of wire.

Question 2 options:

It will stay on


It will go off


It will change colors


It will burn out

HERES ANOTHER FOR YOU GUYS! :)

Answers

Answer:

It will go off.

Explanation:

Since the two bulbs are connected in series with the battery, when one bulb breaks breaks the circuit hence flow of current is stopped from moving to the other bulb

Hello! Does anyone know how the structural formula of 2, 2 dimethyl butane is? Please help!

Answers

Answer:

I have it.

Explanation:

Explain how the need for energy is the driving force of the oxygen cycle.

Yet again earth science

Answers

Answer:

Engery is the driving force of the oxygen cycle is photosynthesis itself, which is responsible for the creation and maintenance of earth's atmosphere.Plants are able to use the energy of sunlight to convert carbon dioxide and water into carbohydrates and oxygen.

Answer:

Energy is the main force of the oxygen cycle and not to mention also photosynthesis, which is responsible for the creation of the earth's atmosphere. This would also mean that plants are the main focus of the Oxygen cycle and energy is needed to make plants. So without energy, no plants would exist!  Not to mention the oxygen cycle wouldn't work without energy.  Plants are also able to use the energy of sunlight to convert carbon dioxide and water into carbohydrates and oxygen.

Hope this helps! :)

Explanation:

Describe what happens when two negatively charged particles interact with one another. (plz help 40 points!)

Answers

Answer:

When two negatively charged particles interact with one another, the particles repel with each other. Opposite charges attract while like charges repel. A negatively charged object will exert a repulsive force upon a second negatively charged object.

Explanation:

HELP!!
Which one is balanced?
WILL GIVE BRAINLEST!!!!​

Answers

Answer:

B

Explanation:

I believe c is the answer but maybe wrong though

30 POINTS!! ILL MAKE BRAINLIEST!!

Answers

Thanks! also that's a lot use a calculator.!

yeah use a calc lol^^^^

The burning of a sample of propane generated 1 04.6 kJ of heat. All of this heat was used to heat 500.0 g of water that had an initial temperature of 20.0/C. What was the final temperature of the water?

Answers

Answer: 70.0°C

Explanation:

Quantity of heat = Mass * Specific heat * Change in temperature

Quantity of heat = 104.6 KJ

Mass = 500.0 g

Specific heat of water is 4.18 J/g°C

Change in temperature assuming final temperature is x = x - 20

Units should be in grams and joules:

104,600 = 500 * 4.18 * (x - 20)

104,600 = 2,090 * (x - 20)

x - 20 = 104,600/2,090

x = 104,600/2,090 + 20

x = 69.8

= 70.0°C

Describe how the composition of the upper mantle is different from the lower mantle?

a. The upper mantle is made of solid rocks and lower mantle is made of melted rocks and minerals
b. The upper mantle is made of melted rocks and minerals and lower mantle is made of solid rocks
c.The upper mantle is made of lava and the lower mantle is made of magma

Answers

Answer:

b

Explanation:

Answer:

it is B hope I helped

=

Explanation:

Find the number of moles if you have 1.2 x 1048 copper atoms.

Answers

Answer:

1.993 × 10^(24) moles

Explanation:

From avogadro's number, we have that;

1 mole of atoms contain 6.022 × 10^(23) atoms

Therefore, 1.2 x 10^(48) atoms of copper will contain;

(1.2 x 10^(48) × 1)/(6.022 × 10^(23)) = 1.993 × 10^(24) moles

Order the following atoms from smallest to largest atomic radius: C, N, P

Answers

Answer:

N, C, P

Explanation:

I rueuueueuueuebdhdjjfkdjdjfjfjfjg

All of the following rivers are labeled on the map above except the __________ River.
A. Danube
B. Volga
C. Lena
D. Ob

Answers

The answer for this problem would be c
The answer would be C

When something heats up it moves faster when something close down it moves slower

Answers

Answer:

Yes

Explanation:

Answer:

THATS WHAT SHE SAID

Explanation:

Most of the carbon in the rocks that form Earth's mantle and crust was stored there when Earth formed. The rest of Earth's carbon is stored and exchanged in many ways.In a model of the carbon cycle, which process does NOT contribute directly to the storage of carbon within sediment?

Answers

Answer:

Photosynthesis.

Explanation:

In photosynthesis process, carbondioxide gas enters into plant leaves from which plant produces organic molecules such as glucose. This glucose helps the plant to increase it growth and complete development stages and finally the plant dies and buried in the soil so due to decomposition process, the carbon present in the plant body releases in the soil and become part of sediments. So indirectly photosynthesis process provides carbon to the soil.

Which of the following has the highest mass?
O 1 liter
O 1 mole
O 1 gram
1 molecule

Answers

Liters are used to measure water and a liter is about as much as a big pop bottle. Moles measure large quantities of small entities, and grams measure small things like salt.

It’s the liter

Other Questions
breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please! 2 3/8 x 3 3/4 divided by 2 2/3 HELP PLEASEAt Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event? A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites. B. It provided money to businesses responsible for toxic waste sites to clean up their pollutionC. It helped boost the economy among those waste sites D. It helped identify toxic waste site and move people away from them what do you understand by the term current state and define its SI unit......... help please! thank you!The ratio of cats to dogs is 8/6, which can be simplified to 4/3. The ratio of fish to birds is 20/2. Can it be simplified to 10? Why or why not? Answer in complete sentences. Its an inequality I need the work for it ik the answer Which of the following stimuli is least likely to cause an animal to vomit?A.A bacterial infection in the stomachB.Feeling cold after stepping outsideC.Drinking large amounts of water at onceD.Getting dizzy after spinning in circles do you have any song writing tips whats 43.6 rouded to the nest tenth