What’s the answer I’m so confused!!!

Whats The Answer Im So Confused!!!

Answers

Answer 1

Answer: C

If you leave behind 0.5 then instead of 24 the correct answer would be 22.


Related Questions

a picture is enlarged by keeping its width the same and increasing its length. the scatter plot shows the perimeter of the picture (y) for different lengths (x):plot the ordered pairs 20, 60 and 30, 80 and 40, 100 and 50, 120 and 60, 140which function best represents the data in the scatter plot?

Answers

The function best represents the data in the scatter plot is y = 2x + 20.

The function of the straight line has the general formula: y = mx + c

where m is the slope of the line, and c is the y-intercept

So first, we will need to find the slope (m):

The slope can be calculated with the points (x₁, y₁) and (x₂, y₂) as follows:

m = (y₂ - y₁)/(x₂ - x₁)

= 120 - 60/50 - 20

= 60/30

= 2/1

So, now we have the slope of our equation y = 2x + b but we still need to find b (or where the y intersects.)

Now, consider the ordered pair (20, 60)

y = 2x + b

60 = 2 × 20 + b

b = 60 - 40

b = 20

Now, put the value of b in y = 2x + b, and we get

y = 2x + 20

Also, b can not be -20 because this is a positive y-intercept, and we know it has a slope of 2.

Therefore the function is y = 2x + 20

--The given question is incomplete; the complete question is

"A picture is enlarged by keeping its width the same and increasing its length. The scatter plot below shows the perimeter of the picture (y) for different lengths (x):

Plot the ordered pairs 20, 60 and 30, 80 and 40, 100 and 50, 120 and 60, 140

Which function best represents the data in the scatter plot?

y = 2x − 20

y = 2x + 20

y = x − 20

y = x + 20"--

To know more about scatter plot, here

https://brainly.com/question/29231735

#SPJ4

a circular disk is to be manufactured with a radius of 26 cm. use differentials to estimate the maximum error in the calculated area of the disk if the possible error in measuring the radius is 0.25 cm.

Answers

The maximum error in calculating the area of the disk is approximately 0.25 cm * 2π * 26 cm = 16.3 cm².

The maximum error in the calculated area of the disk can be estimated using differentials. A = r2, where r is the circle's radius, is the formula for calculating a circle's area.. Differentiating this equation with respect to r gives us A' = 2πr. Plugging in the given values, we get A' = 2π * 26 cm = 161.6 cm². If the possible error in measuring the radius is 0.25 cm, then the maximum error in calculating the area of the disk is 0.25 cm * A' = 0.25 cm * 161.6 cm² = 16.3 cm². Therefore, the maximum error in the calculated area of the disk is approximately 16.3 cm².

Learn more about area here

https://brainly.com/question/13194650

#SPJ4

you can assess normality of data using what?

Answers

You can assess normality of data using D. Pearson's Measure of Normality

What is Pearson's Measure of Normality ?

Pearson's Measure of Normality, also known as Pearson's Test for Normality, is a statistical test that is used to assess whether a set of data is normally distributed.

It is based on the skewness and kurtosis of the data, and it provides a p-value which indicates the probability that the data is from a normal distribution. Pearson's test is considered as one of the most common statistical test used to check normality of data.

Find out more on normality of data at https://brainly.com/question/28475676


#SPJ1

The full question is:

You can assess normality of data using A. Pearson's Index of Skewness B. Pearson's Test C. Pearson's p-value D. Pearson's Measure of Normality


6/10 Darlene runs kilometer in the morning and 1 2/5 kilometers in
About how many kilometers does Darlene run?
the afternoon.

Answers

The number of kilometers that Darlene runs is given as follows:

2.4 kilometers.

How to obtain the distance that Darlene runs?

The distance that Darlene runs is obtained applying the proportions in the context of the problem.

The proportion is applied to convert the mixed number to decimal, adding the integer part to the division of the numerator by the denominator.

The distances are given as follows:

Morning: 1 km.Afternoon: 1 + 2/5 = 1 + 0.4 = 1.4 km.

Hence the total distance is of:

1 + 1.4 = 2.4 km.

Missing Information

She ran 1 km in the morning.

More can be learned about proportions at https://brainly.com/question/24372153

#SPJ1

the solid whose base is the region bounded by x-y^2 and the line y-1 and whose cross sections perpendicular to the base and parallel to the x-axis are squares

Answers

The solid whose base is the region bounded by the parabola y = x^2 and the line y = 1 and whose cross sections perpendicular to the base and parallel to the x-axis are squares is a parabolic pyramid.

A parabolic pyramid is a pyramid whose base is a parabola and whose lateral faces are formed by rectangles that are perpendicular to the base. The height of the pyramid is determined by the y-coordinate of the point where the parabola and the line y = 1 intersect. The length of the side of the square cross section is determined by the x-coordinate of the point where the parabola and the line y = 1 intersect.

The base of the solid is a parabolic region, defined by the parabola y = x^2 and the line y = 1, and the cross sections are squares, perpendicular to the base, and parallel to the x-axis. This solid is called a parabolic pyramid.

To learn more about parabolic pyramid

Visit; brainly.com/question/26701251

#SPJ4

14. A brand-new school district needs to generate ID numbers for its student body. The district anticipates a total
enrollment of 75,000 students within the next ten years. Will a five-digit ID number using the symbols 0, 1,…, 9
be enough? Explain your reasoning using logarithms

Answers

The different combinations of the five-digit number formed are enough to create ID numbers.

What is meant by combinations?

Combinations are ways to choose elements from a collection in mathematics where the order of the selection is irrelevant.

We first find the total number of 5-digit enrollment IDs that can be created using all possible combinations of numbers possible.

Since each digit of the five-digit number can be from 0-9, there are ten possible values for each digit.

So the total number of ways a five-digit number can be formed

= 10*10*10*10*10 = 100,000

For the given question, it is mentioned that only 75,000 students are expected to be enrolled in the next ten years,

Since 100,000 is greater than 75,000 the five-digit ID number will be enough.

But if the school is to last longer than ten years, it is safe to use a six or seven-digit ID number.

Therefore a five-digit Id number using symbols from 0-9 will be enough.

To learn more about combinations, follow the link.

https://brainly.com/question/28065038

#SPJ1

according to the social class model developed by gilbert, which is based on weber's analysis of the class structure, the upper class in the united states includes about of the population. group of answer choices 3 percent 1 percent 8 percent 12 percent

Answers

According to the social class model developed by Gilbert and Kahl, and based on the theory of Weber, the upper (capitalist) class of the United States includes about b) 1 percent of the population.

In the United States, the upper class, or capitalist class, is estimated to comprise about 1 percent of the population.

This is according to the social class model developed by Gilbert and Kahl, which is based on the theory of Weber.

This model suggests that the upper class is made up of those who own the majority of the nation's wealth and power, and are thus able to influence governmental decisions.

While the upper class may be small in size, it is highly influential and its members often have the resources to enact large-scale change.

To learn more about United States, click here:

https://brainly.com/question/1527526

#SPJ4

If 4 -letter "words" are formed using the letters A, B, C, D, E, F, G, how many such words are possible for each of the following conditions: (a) No condition is imposed. Your answer is : (b) No letter can be repeated in a word. Your answer is : (c) Each word must begin with the letter A and letters can be repeated. Your answer is : (d) The letter C must be at the end and letters can be repeated. Your answer is : (e) The second letter must be a vowel and letters can be repeated. Your answer is :

Answers

In this case, there are 8 letters, so the total number of 4-letter words possible is 8^4 = 4096.

(b) In this case, each letter can be used only once, so we must choose 4 different letters out of 8 letters. This can be done using the combination formula C(8,4) = 70.

(c) Since each word must begin with the letter A, the remaining 3 letters must be chosen from the remaining 7 letters. This can be done using the combination formula C(7,3) = 35.

(d) The letter C must be at the end, so the first 3 letters must be chosen from the remaining 7 letters. This can be done using the combination formula C(7,3) = 35.

(e) The second letter must be a vowel, so the first letter can be chosen out of 4 letters (A, E, I, O). The remaining 3 letters can be chosen out of 7 letters. This can be done using the combination formula C(4,1) x C(7,3) = 140.

Learn more about combination here:

https://brainly.com/question/20211959

#SPJ4

Need help with #4 please :)

Answers

Answer:

Step-by-step explanation:

the answer is 69

Answer:yes

Step-by-step explanation:

The Angle-Side-Angle Postulate (ASA) states that if two angles and the included side of one triangle are congruent to two angles and the included side of another triangle, then the two triangles are congruent.

Here we see two sides being congruent and one angle, this means that the other angles are also congruent, as only one triangle can be formed with two set sides and an angle. therefore we know both triangles are congruent

Which is greater -6, 6, or -2

Answers

6 is the greatest number

help me please (asap)!!!!

Answers

Answer:

no more  Fortnight gift cards

Step-by-step explanation:

please help me with math

Answers

Answer: 3rd Picture

Step-by-step explanation: Equation: y=1/3x+4

Intercepts y axis at 4, and with the slope equation (rise/run), then it rises 1 and runs 3, thus being the 3rd picture.

compare the original function with the 1st through 4th order approximations for different values of x,

Answers

First order approximation = (sin(x+dx)/(x+dx)^3 - sin(x)/x^3)/dx and ((sin(x-(2*dx))/(x-(2*dx))3) is a formula for calculating the fourth-order

Function output for the first order approximation is first order approx (x,dx)

(x3*(cos(x)) analytical derivative =

-sin(x)*3*x^2)/x^6;

First order approximation: % forward differencing = (f(x+dx) - f(x))/dx%

first-order approximation = (sin(x)/x3 - sin(x)/x+dx)/(x+dx)3)/dx;

output is equal to Abs(FirstOrderApproximation - AnalyticalDerivative);

end

Function output for the fourth-order approximation is fourth-order approx (x,dx)

(x3*(cos(x)) analytical derivative =

-sin(x)*3*x^2)/x^6;

((sin(x-(2*dx))/(x-(2*dx))3) is a formula for calculating the fourth-order approximation. 8*(sin(x-dx))/(x-dx) + 8*(sin(x+dx))/(x+dx) - ((sin(x+(2*dx))/(x+(2*dx))3))/(12*dx);

output for the error term is abs(approximation of first order - analytical derivative);

end

Know about first-order approximation

https://brainly.com/question/27931524

#SPJ4

6. A parabola has focus (-1, 6) and directrix y = 4. Determine whether each point on
the list is on this parabola. Explain your reasoning.
a. (-1,5)
b. (1,7)
c. (3,9)

Answers

a. (-1,5) is on the parabola

b. (1,7) is NOT on the parabola

c. (3,9) is NOT on the parabola

How to find if they are on the parabola

a. (-1,5)

The distance from the point (-1,5) to the focus (-1,6) is sqrt((-1-(-1))^2 + (5-6)^2) = sqrt(0+1) = 1

The distance from the point (-1,5) to the directrix y=4 is the absolute value of the y-coordinate of the point - the y-coordinate of the directrix = abs(5-4) = 1

Since the distances are equal, the point (-1,5) is on the parabola.

b. (1,7)

The distance from the point (1,7) to the focus (-1,6) is sqrt((1-(-1))^2 + (7-6)^2) = sqrt(2^2 + 1^2) = sqrt(5)

The distance from the point (1,7) to the directrix y=4 is the absolute value of the y-coordinate of the point - the y-coordinate of the directrix = abs(7-4) = 3

Since the distances are not equal, the point (1,7) is not on the parabola.

c. (3,9)

The distance from the point (3,9) to the focus (-1,6) is sqrt((3-(-1))^2 + (9-6)^2) = sqrt(4^2 + 3^2) = sqrt(16+9) = sqrt(25)

The distance from the point (3,9) to the directrix y=4 is the absolute value of the y-coordinate of the point - the y-coordinate of the directrix = abs(9-4) = 5

Since the distances are not equal, the point (3,9) is not on the parabola.

Read more about parabolas here:

https://brainly.com/question/25651698

#SPJ1

It would take Jack $4$ hours to mow the lawn if he works alone. Fortunately, after he mows for $2$ hours, Jill joins him. They finish mowing $90$ minutes later. How many minutes would it have taken for Jill to mow the entire lawn alone?

Answers

1/4+1/x=1/3
1/x=4/12 3/12
1/x=1/12
12=x
It takes Jill 12 hours to mow the lawn
12 hours = 720 minutes

Answer: 720

Step-by-step explanation:

Question 8
A scientist determines a plot of forest has a stable population of about 100 deer. Deer live in the interior of ecosystems. Then, a highway is built, splitting the forest into two plots of equal size.

After a couple of years, the scientist checks the number of deer in the two plots and finds the total population to be 60 deer.

Why did the carrying capacity of the habitat drop when the forest was split into two plots?

Select all that apply.

Responses

The two plots of forest have more edges than a single plot, causing a decrease in interior species. The two plots of forest have more edges than a single plot, causing a decrease in interior species.

The highway changed the climate of the region, making it less suitable for deer.The highway changed the climate of the region, making it less suitable for deer.

The two plots of forest provided more interior habitat for species other than deer. The two plots of forest provided more interior habitat for species other than deer.

The highway affected the growth of many plant species, which serve as food for the deer.

Question 9

A chicken-sized, flightless bird lives on an island in the middle of an ocean. The bird has some natural predators, which it avoids.

When people arrive at this island, they bring cats with them. Cats also hunt the bird.

What is the impact in the short term of bringing cats to the island?

Responses

The number of birds will remain the same.The number of birds will remain the same.

It is not possible to know whether there will be fewer or more birds.It is not possible to know whether there will be fewer or more birds.

There will be fewer birds.There will be fewer birds.

There will be more birds.

Answers

a) The highway affected the growth of many plant species, which serve as food for the deer. Option D

b) There will be fewer population of the birds. Option C

What is the carrying capacity?

The carrying capacity of an ecosystem is the maximum number of individuals of a particular species that can be supported by the available resources in that ecosystem.

It is the point at which the population growth rate becomes zero, as the resources needed to sustain the population (such as food, water, and space) become limited. Carrying capacity can change over time due to factors such as climate change, pollution, and human activity.

Learn more about carrying capacity:https://brainly.com/question/797991

#SPJ1

determine whether each of the following formulas is a tautology, contingency, or contradiction (this means always true, sometimes true, never true). show how you arrived at each answer. use equivalence-style proofs.

Answers

From the given formulas, formula A is a tautology or always true. Formula B is a contradiction or never true. And, formula C is contingency or sometimes true.

Using the truth table, a given expression is said to be in tautology when all the values are true. The given expression is said to be a contradiction when all the values are false or never true. And the given expression is said to be contingency when the values are either true or false.

In the given formulas, formula A (p→q)∨(q→r) is a tautology. This is because the values in all rows are true (T).

In the given formulas, formula B (¬(¬(p∧q)→(p→¬q))) is a contradiction. This is because the values in all rows are false (F).

In the given formulas, formula C ((¬p∨q)→q) is a contingency. This is because some values are true and some are false.

The complete question is -

Determine whether each of the following formulas is a tautology, contingency, or contradiction (this means always true, sometimes true, never true). Show how you arrived at each answer. Use equivalence-style proofs.

A. (p→q)∨(q→r)

B. ¬(¬(p∧q)→(p→¬q))

C. ((¬p∨q)→q)

To know more about the truth table:

https://brainly.com/question/30221193

#SPJ4

Which of the following variables are quantitative?Number zip codeFavorite colorShoe sizeArea code

Answers

Quantitative variables can be used to measure and contrast data because they have numerical values. Measurements like shoe size, height, weight, and temperature are examples of quantitative variables.

Quantitative variables can be used to measure and contrast data because they have numerical values. They come in discrete or continuous forms. While continuous variables have an infinite number of possible values, such as decimal numbers, discrete variables have specific values, such as integers or whole numbers. Measurements like shoe size, height, weight, and temperature are examples of quantitative variables. Quantitative variables can be used to describe a population's varied characteristics, such as the median age or annual income of a given group. The average height of men and women, for example, might be used to compare two populations. The use of quantitative variables is crucial for comprehending and analyzing data. They enable academics to spot patterns and trends in data They enable researchers to find patterns and trends in data, anticipate the future, and form conclusions.

Learn more about variable here

brainly.com/question/29583350

#SPJ4

the complete question is

Which of the following variables are quantitative? Number zip codeFavorite colorShoe sizeArea code and Shoe size.

What is the ratio of 1.5-inch screws to 2.5-inch screws, written in three different ways? Do not reduce.

Answers

The ratio of two screws written in three different forms are,

2.5 : 1.5, 5 : 3 and 1.5/2.5.

What are ratio and proportion?

A ratio is a comparison between two similar quantities in simplest form.

Proportions are of two types one is the direct proportion in which if one quantity is increased by a constant k the other quantity will also be increased by the same constant k and vice versa.

In the case of inverse proportion if one quantity is increased by a constant k the quantity will decrease by the same constant k and vice versa.

Given, Two screws are in the ratio of 1.5 inches and 2.5 inches.

It can be written as 2.5 : 1.5

It can also be written as 2.5×10 : 1.5×10 = 25 : 15 = 5 : 3.

It can also be written as a fraction as, 1.5/2.5.

learn more about proportion here :

https://brainly.com/question/7096655

#SPJ1

4y=12x=3 and let y+3x+1 a solution

Answers

The system of linear equations 4 · y - 12 · x = 3 and y + 3 · x = 1 has the following solution: (x, y) = (1 / 24, 7 / 8)

How to solve a system of linear equations

In this question we find the case of a system of two linear equations with two variables, this case may have an unique solution. This system can be solved by algebraic properties.

First, write the system of linear equations:

4 · y - 12 · x = 3

y + 3 · x = 1

Second, clear y in the second equation:

y = 1 - 3 · x

Third, substitute in the first equation:

4 · (1 - 3 · x) - 12 · x = 3

Fourth, expand the expression and clear variable x:

4 - 12 · x - 12 · x = 3

4 - 24 · x = 3

24 · x = 4 - 3

24 · x = 1

x = 1 / 24

Fifth, determine the value of variable y:

y = 1 - 3 · (1 / 24)

y = 1 - 1 / 8

y = 7 / 8

The solution to the system of linear equations 4 · y - 12 · x = 3 and y + 3 · x = 1 is (x, y) = (1 / 24, 7 / 8).

Remark

The statement reports several typing mistakes. The system of linear equations is shown below:

4 · y - 12 · x = 3

y + 3 · x = 1

To learn more on systems of linear equations: https://brainly.com/question/20379472

#SPJ1

What is 4 ÷ 1⁄5?

- Answers are appericated.

Answers

Answer: 20

Step-by-step explanation:

Answer:

[tex] \sf \: 4 \div \frac{1}{5} = 20[/tex]

Step-by-step explanation:

Given problem,

[tex] \sf \rightarrow \: 4 \div \frac{1}{5} [/tex]

Let's solve the problem,

[tex] \sf \rightarrow \: 4 \div \frac{1}{5} [/tex]

[tex] \sf \rightarrow \: 4 \times \frac{5}{1} [/tex]

[tex] \sf \rightarrow \: 4 \times 5[/tex]

[tex] \sf \rightarrow \: 20[/tex]

Hence, the answer is 20.

Please help
Fill in each answer box so that the resulting statement is true
View image

Answers

First box
root -1
Second box
i
Third box
i3

Graph the line

y=-1/3x-6

Answers

Answer:

the slope is -1/3 and the coordinates are (0,-6) and (3,-7). Below is a picture of the equation graphed.

Step-by-step explanation:

The expression 16n-24 factored using GCF

Answers

The G.C.F. of the expression 16n - 24 is evaluated to be 8(2n - 3).

What is an expression?

Mathematical expressions consist of at least two numbers or variables, at least one arithmetic operation, and a statement. It's possible to multiply, divide, add, or subtract with this mathematical operation.

The given expression is - 16n - 24.

The greatest common factor, which is the product of two or more numbers, is the largest number (GCF). A natural number is created by dividing them by the biggest number (factor).

First of all find the G.C.F of 16n and 24 separately.

It can be written that -

16n = 2 × 2 × 2 × 2 × n

24 = 2 × 2 × 2 × 3

The common prime factor between the two is 2 × 2 × 2 = 8.

So, the GCF of 16n and 24 is 8.

Now use the GCF to factor the expression -

= 16n - 24

= 8(2n) - 8(3)

Using the distributive property -

= 8(2n) - 8(3)

= 8(2n - 3)

Therefore, the GCF value is 8(2n - 3).

To learn more about expression from the given link

https://brainly.com/question/24734894

#SPJ1

help pls i need the answer and fast !!!

Answers

Answer: The slope of the line is 2/3.

The line is not solid, it is dashed.

The area below the line is shaded.

A solution to the inequality is (2,3).

The x-intercept of the boundary line is (-3/2,0)

All the statements except the first one are true about the graph of y< 2/3 x +1.

Step-by-step explanation:


Suppose we fit a least-squares regression line to a set of data. What is true if a plot of the residuals shows a curved pattern?

answer choices
The correlation must be 0.

The correlation must be positive.

A straight line is not a good model for the data.

The regression line might or might not be a good model for the data, depending on the extent of the curve.

Answers

If a plot of the residuals shows a curved pattern, it indicates that a straight line is not a good model for the data. This does not necessarily mean that the correlation between the two variables must be 0 or positive, as the regression line might still be a good model for the data depending on the extent of the curve.

When a least-squares regression line is fit to a set of data, it is used to determine the linear relationship between two variables. If a plot of the residuals (the difference between the observed values and the predicted values from the regression line) shows a curved pattern, it indicates that a straight line is not a good model for the data. This could mean that there is a nonlinear relationship between the two variables or that the data contains outliers that are not accounted for by the regression line. However, it does not necessarily mean that the correlation between the two variables must be 0 or positive, as the regression line might still be a good model for the data depending on the extent of the curve. To determine if the regression line is an accurate model for the data, it is important to visually inspect the plot of the residuals and assess whether the pattern is random or systematic. If the pattern is random, it indicates that the regression line is a good model for the data. If the pattern is systematic, it indicates that the regression line is not a good model for the data and alternative models should be considered.

Learn more about mean here

https://brainly.com/question/15323584

#SPJ4

In a cash drawer, there is $125 in $5 and $10 bills. The number of $10 bills is twice the number of $5 bills. How many of each type of bill is in the drawer?

Answers

Answer:

Step-by-step explanation:

You can use the equations:

x = 2y

where x is the number of $10 bills and y the number of $5 bills and:

10x+5y = 125

Solving gives x=10 and y = 5, or in other words there are 10 $10 bills and 5 $5 bills

twenty-four workers were surveyed and asked how long it takes them to travel to work each day. the data below are given in minutes. 20 35 42 52 65 20 60 49 24 37 23 24 22 20 41 25 28 27 50 47 58 30 32 48 which of the following shows the data in a stem-and-leaf plot?

Answers

Use the data to create a stemplot.

Twenty-four workers were surveyed about how long it takes them to travel to work each day. The data below are given in minutes.

20 35 42 52 65 20 60 49 24 37 23 24

22 20 41 25 28 27 50 47 58 30 32 48

The data in a stem-and-leaf plot:

3/0257

2/0002344578

4/12789

5/028

6/05

Stemplots (Stem-and-Leaf Plots)

Another presentation that is similar to a histogram is a stemplot. In statistics, a stemplot is a tool for presenting quantitative data in a graphical format, similar to a histogram, namely to assist in visualizing the shape of the data distribution which is often used in exploratory analysis. Stemplots were introduced by Arthur Bowley in the early 1900's. However, its general use only began in 1980 after John Tukey's published Exploratory Data Analysis in 1977.

Stem-and-leaf plots provide more information about true values than histograms. As in a histogram, the length of each bar corresponds to the number of events that fall into a given interval. On Histograms. we can only see the frequency value of the data but we don't know what the actual number value is. In contrast to the histogram, in SLP besides we can know the frequency value, we can also know what the actual data value is. This is done by dividing the observed values into two components, stem and leaf.

Learn more about stemplot at

https://brainly.com/question/29433270.

#SPJ4

Find the equation for the plane through the points Po(5,5,2), Qo(-4,0,-2), and Ro(-4,-1,1).
Using a coefficient of - 19 for x, the equation of the plane is

Answers

Ax+by is c is the equation for a line in two dimensions, the equation for a line in three dimensions.

What is the equation of plane formula?The equation of a plane in R has the generic form an x + b y + c z + d = 0, where a, b, and c are the elements of the normal vector n = (a, b, c) that is perpendicular to the plane or any vector parallel to the plane.A line and a point that is not on the line can only be crossed by one plane.Ax+by=c is the equation for a line in two dimensions. It is logical to assume that ax+by+cz=d is the equation for a line in three dimensions. However, this assumption is incorrect since it turns out that this is really the equation for a plane. In contrast to a line, a plane lacks an evident "direction."(5,5,2), Qo(-4,0,-2), and Ro(-4,-1,1).5x + 5y =2-4x + y = -2-4x -y = 1

To learn more about equation of the plane refer to:

https://brainly.com/question/30175060

#SPJ1

using the basic definition show that {3n-2/n}n=1 converges

Answers

The sequence (3n-2/n)n=1 converges to 1.

How to determine if the series converges

To show that (3n-2/n)n=1 converges, we need to find the limit as n approaches infinity.

Using algebraic manipulation, we have the following steps

lim (3n-2/n)n = lim (3-2/n)^n

lim (3n-2/n)n = (3-2/∞)^∞

lim (3n-2/n)n = 1^∞

lim (3n-2/n)n = 1

The basic definition of convergence states that a sequence converges if the limit of the sequence as n approaches infinity is equal to a finite number

Since the limit of (3n-2/n)n as n approaches infinity is 1, we can conclude that the sequence converges to 1.

Read more about sequence at

https://brainly.com/question/29431864

#SPJ1

Other Questions
A member of one species (the predator) feeds directly on all or part of a living organism (the prey) as part of the food web. Randomly selecting 20 cards out of 52 card deck, the probability of each outcome will be basically the same whether it is done with or without replacement 1TRUE OR FALSE? 1. 50cm of 0.5 mol/dm NaOH solution and 50cm of 0.5mol/dm HNO3 were mixed at 20c and stirred in a calorimeter with negligible heat capacity. The temperature of the mixture rose to 23.2c.the density of each solution is 1.0g/cm and the specific heat capacity of each solution is 4.18J/K/g.calculatei.the enthalpy for the neutralizationii.calculate the change in enthalpy per mole of water formed last year small manufacturing company netted $540,000 the net profit increased this year by 135% what is the net profit of the company this year Becky had net sales (all on account) in 2017 of $820000. At December 31, 2017, before adjusting entries, the balances in selected accounts were: accounts receivable $1000000 debit, and allowance for doubtful accounts $2120 debit. Becky estimates that 2% of its accounts receivable will prove to be uncollectible. What is the net realizable value of the receivables reported on the financial statements at December 31, 2017 there are 10 employees in a particular division of a company. their salaries have a mean of $70,000, a median of $55,000, and a standard de?viation of $60,000. the largest number on the list is $ 100,000. by accident, this number is changed to $ 1,000,000. which nims structure develops recommends and executes public information Using y = 6 - 2x, plot the ordered pairs from the table. Then graph the function represented by the ordered pairs and tell whether the function is linear or nonlinear. Part 1 out of 3 Complete the table. Input, x Output, y Check -1 3 Next a client who is taking an oral hypoglycemic daily for type 2 diabetes develops an infection with anorexia. which advice will the nurse provide to the client? a solution is prepared at that is initially in dimethylamine , a weak base with , and in dimethylammonium bromide . calculate the ph of the solution. round your answer to decimal places. find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange.