What is the process of Sexual reproduction of a Hammerhead Shark?

Answers

Answer 1

Answer:

The process of sexual reproduction of a hammerhead shark is that the hammerhead sharks exhibit a viviparous mode of reproduction with females giving birth to live young.

Explanation:

Answer 2

Answer:

The hammerhead sharks exhibit a viviparous mode of reproduction with females giving birth to live young. Like other sharks, fertilization is internal, with the male transferring sperm to the female through one of two intromittent organs called claspers. The developing embryos are at first sustained by a yolk sac.

Explanation:

hope this helps


Related Questions


6. In general, as both the force and velocity of impact increase, what happens to the diameter of
the resulting blood droplets?

Answers

Answer: depending on viscosity, mass and velocity of impact, if droplet integrity is maintained, as velocity increases, diameter will increase from

Approximately d*sqrt(2) to 2*sqrt(d^3/6a) where d is original diameter and a is thickness when the droplet flattens into a disc.

Explanation:

This applies generally to any liquid droplet, which by inference falls and impacts a solid surface. The impact force is mgh where m= mass, g= acceleration due to gravity, h= initial height.

A liquid droplet deforms on impact. Assume the drop is sperical, then the deformation distance, d= diameter of the droplet then the average impact force = mgh/d.

The droplet may spread, splash or bounce, depending on viscosity and force, which depends on mass and velocity immediately before impact.

All than can be said is that if the droplet maintains integrity it could achieve the shape of half a highly flattened oblate spheroid. Approximating this with a flattened disc of thickness a, and an original volume of 4/3pi(d/2)^3, the volume as a disc =a*pi*r^2 so the horizontal diameter = 2*sqrt(d^3/6a)

It is not really possible from the available data to determine whether the droplet would remain its integrity, but at sufficiently low force/velocity, the droplet could retain a near-hemispherical shape, giving a horizontal diameter of the hemisphere = d*sqrt(2)

As velocity increases, if integrity is maintained, the diameter will increase from the second approximation to the first

what animal kingdoms were divided

Answers

Answer:

The scheme most often used currently divides all living organisms into five kingdoms: Monera (bacteria), Protista, Fungi, Plantae, and Animalia. This coexisted with a scheme dividing life into two main divisions: the Prokaryotae (bacteria, etc.) and the Eukaryotae (animals, plants, fungi, and protists).

If two hybrid tall pea plants are crossed what is the probability that the offspring will have the tall phenotype?

Answers

Answer:

There is a high probability that the Pea plant will have a High phenotype!

Explanation:

Because both "parent plants" are tall, this will cause the offspring to also be tall, this will be because it in it's genes or in other words DNA too be strong.

which wall structures are found in plant cells but not in animal cells check all that apply
cell wall
cell membrane
endoplasmic reticulum
nucleus
chloroplasts
mitochondria​

Answers

Answer:

cell wall, chloroplasts

Explanation:

no explanation, just the correct answer

Answer:

Options: A and E

Explanation:It was correct on edg 2021, Have a blessed day.

When equipment malfunctions, a(n) _____ needs to be initiated.

A) Notification

B) Paper Work

C) Alarm

D) Work Order

Answers

Answer: Alarm

Explanation:

When equipment malfunctions, an alarm should be initiated to bring the malfunction to the attention of the relevant personnel.

This will ensure that whatever adverse effects the malfunction could have caused is mitigated and the machine can be attended to on time to prevent further damage.

4.
What is the importance of biodiversity to humans and to ecosystems?

Answers

Answer:

Ecological life support- biodiversity provides functional ecosystem that supply oxygen, clean air and water, pollination of plants, pets, control, wastewater treatment and many ecosystem services.

Explanation:

looked it up

Journal
1. The following are the functions of the skeletal system, except
a. It gives shape to the body
b. It serves as the framework of the body.
c. It protects the internal organ of the body.
d. It circulates oxygen and removes carbon dioxide.
2. Why is bone marrow important to the body?
a. It stores much fat.
b. It makes the bone strong.
c. It produces red blood cell.
d. It produces new bone cell.​

Answers

Answer:

1.

Answer: D

2.

Answer: A,C,D

3. A house has several systems, such as the electrical system, plumbing system, and
heating and cooling system. In what ways are the systems of a house similar to
human body systems?

Answers

Answer: The systems regulate the house, the same way our body system helps regulate our body. If it wasn’t for the electrical system, plumbing system, heating, and cooling system the house wouldn’t be regulated or able to live in. Just like if our bodies isn’t being regulated, we can't live.

I hope this could help you! ^^

from his monohybrid crosses, Mendel developed his first law

Answers

Answer:

Im confused but if your asking for Medel's first law it would be states that for the pair of alleles an individual has of some gene (or at some genetic locus), one is a copy of a randomly chosen one in the father of the individual, and the other if a copy of a randomly chosen one in the mother, and that a randomly chosen one will be copied

Explanation:

In those parts of equatorial Africa where the malaria parasite is most common, the sickle-cell allele constitutes 20% of the b hemoglobin alleles in the human gene pool. In the United States, the parasite that causes malaria is not present, but African-Americans whose ancestors were from equatorial Africa are present. What should be happening to the sickle-cell allele in the United States, and what should be happening to it in equatorial Africa

Answers

Answer:

directional selection, stabilizing selection

Explanation:

Directional selection is a type of natural selection that favors one extreme phenotype over other phenotypes, thereby modifying allele frequency in the direction of the favored phenotype. This type of positive selection is the main cause of phenotypic diversification. In the USA, the environment created a selection pressure that favored individuals that don't have the defective sickle-cell allele, thereby reducing its frequency in this population. Stabilizing selection, also known as balancing selection, is a type of natural selection where the most common phenotype is selected in the population, thus predominating in future generations. In equatorial Africa, the defective sickle-cell allele is present in a high frequency because individuals that are heterozygous for this allele are less susceptible to malaria, and therefore balancing selection should maintain this allele in the African population.

Indicate the correct designation of the paired sex chromosomes.
male: XY
female: YY

Answers

Answer:

Out of the written pairs, males have XY while females have XX

Explanation:

can someone please help me

Answers

Answer:

A. Tap water is a homogenous mixture and distilled water is a pure substance.

Explanation:

Tap water can be classified as a homogeneous mixture because it contains equal amounts of dissolved minerals and other chemicals that are even throughout the mixture.

In the other hand, distilled water is classified as a pure substance because it contains definite amount of atoms of elements and unique chemical properties that forms water.

10. What enzyme unzips or breaks apart DNA for replication?
A. Helicase
B. Ligase
C. Polymerase
D. Okazaki

Answers

The answer is A which is helicase

Answer:

a. Helicase Helicase the double helix bond is broken.


7. What two reactants of photosynthesis are used for the light reactions?
a. Carbon dioxide, water
b. Carbon dioxide, sunlight
C. water, sunlight
d. glucose, sunlight

Answers

Answer:

sunlight, carbon dioxide, water

Explanation:

Summarize how dead organisms become oil or natural gas (2-3 sentences)

Please do this for me? I will give brainliest when it pops up if you help me! x thx

Answers

Answer:

Petroleum, also called crude oil, is a fossil fuel. Like coal and natural gas, petroleum was formed from the remains of ancient marine organisms, such as plants, algae, and bacteria. ... Millions of years ago, algae and plants lived in shallow seas

which image shows a non renewable resource?
1
2
3
4

Answers

I think it’s 1

because non renewable resource is gas, Oil, nuclear energy, and natural gas.

How can fossils help us
understand the Earth's history?

Answers

Answer: By studying fossils, we can tell how long someone has been on the earth for.

Explanation: We can easily learn where they lived, how they lived, and their past.

Help me now please!!!!!!!!

Answers

The answer is a can I have brainly

What is a global hectare (gha)?

Answers

Accounting unit of ecological protection

PLZ ASAP
A scientist is using a microscope to observe a type of
bacteria.

Which two structures would the scientist most likely see?PLEASE EXPLAIN WHY

A:nucleus and DNA
B:DNA and cell wall
C:cell wall and vacuole
D:vacuole and nucleus

Answers

Answer:

The two structures most likely to be observed by the scientist when looking at a type of bacteria under the microscope are cell wall and vacuole (option C).

Explanation:

Bacteria are prokaryotic organisms that lack a nucleus, most of the organelles, and whose DNA is dispersed in the cytoplasm. Some types of bacteria have a plasma membrane surrounded by a cell wall, and may be equipped with vacuoles to perform their functions.

It is very likely that two structures that are most likely to be differentiated when a type of bacteria is observed under the microscope are the cell wall and the vacuole, according with information above.

The other options are not correct because:

    A and D. Bacteria lack a nucleus.

    A and B. Bacterial DNA is dispersed in the cytoplasm and is very difficult to observe under the microscope.

Answer:

cell wall vacuole

Explanation:

If the sodium/potassium ion pump were to stop functioning, what would eventually happen to the concentration gradients of sodium and potassium ions across the membrane

Answers

Answer:

The correct answer would be - concentration gradient will reach to equilibrium.

Explanation:

If the Na+/K= ion pump stops working which is to pump the sodium and potassium ion across the cell membrane. The movement takes place in 3:2 ratio with the help of ATP.

Eventually, the concentration gradients of sodium and potassium would be equal and found equilibrium across the membrane. This equilibrium would be reached due to passive transport that occurs in either direction across the membrane.

In kolhbergs conventional stage of moral development moral decisions are based on?

A) nature and nurture
B) society’s expectations and laws
C) trust or mistrust
D) attachment and temperament

Answers

Answer:

b

Explanation:

The type of selection where the characteristics on both extremes are selected against is

Answers

Answer:

stabilizing selection

what in your dna are responsible for determining the traits that are expressed in an organism
1. mutagens
2. replication
3. cell
4. gametes
5. genes
6. meiosis

Answers

Answer:

Genes

Explanation:

Gene. A segment of a DNA molecule (a sequence of bases) that codes for a particular protein and determines the traits (phenotype) of the individual. A gene is the basic unit of heredity in a living organism.

Chloroplasts contain chlorophyll and carotenoids. Chlorophyll directly absorbs light for use in photosynthesis.
Carotenoids absorb light and transfer the energy from light to chlorophyll. The efficiency of photosynthesis varies with
the wavelengths of the light that illuminates the chloroplasts. In an experiment to study the relationship between the
incoming light wavelengths and the chemical reactions of photosynthesis using a species of green algae, a researcher
labeled the COt2 supply to the algae with 14C, and the H20 with 180.
Which of the following results is expected?
O More 14C is found in the algae when it is illuminated by green light than when it is illuminated by blue-violet and red
light.
O More 180 is found in the algae when it is illuminated by green light than when it is illuminated by blue-violet and red
light
O More 14C is found in the algae when it is illuminated by blue-violet and red light than when it is illuminated by green
light.
O More 180 is found in the algae when it is illuminated by blue-violet and red light than when it is illuminated by green
light
Mark this and return
Save and Exit
Next
Submit

Answers

Answer:

D

Explanation:

Correct me if I'm wrong

24. Four identical rocks four four identical rocks were dropped into a stream and were
washed downstream. Which of the rocks below was prob-
ably transported the least distance.

Answers

rock #3 because it’s one of the bigger ones and it is also a rectangle shape making it more difficult for it to just roll on down

Less distance may be traveled with grains whose sizes are greater and more erratic. This is because as a stream moves downstream, its velocity progressively diminishes, causing the big and irregular grains to settle the first, hence option 3 is correct.

How are sediments transported?

Both a reduction in particle size and rounding of initially angular pieces are effects of the protracted transport of material by water and wind current. The grains get smaller and more spherical the farther they have to travel.

Erosion, transport, and deposition all result in the formation of sedimentary rocks. A sediment's grain size provides crucial details on (1) the agent that caused the erosion/transport of the sediment and (2) the current's speed.

Therefore, as a stream moves downstream, its velocity progressively diminishes, causing the big and irregular grains to settle the first, hence option 3 is correct.

Learn more about the sediments, here:

https://brainly.com/question/16526541

#SPJ2

Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron​

Answers

Answer:

Oxygen

Explanation:

-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.

-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.

what are the reproductive systems of insects?​

Answers

Hey! Your answer to this question..

What are the reproductive systems of insects?

Insects that’s is female can make eggs, receive and store sperm, manipulate sperm from different males. They can also lay eggs of course. Insects reproductive systems are made of a pair of ovaries, accessory glands, one or maybe even more spermathecae, and lastly ducts connecting these parts. The ducts and spermathecae are line with a cuticle.

Bam hi cuts between what bases

Answers

bam hi cuts?
can you clarify what that is so i can help you?

How could natural selection affect humans?

Answers

Answer:

Explanation:

an example is the ability to endure the sugar, lactose, in milk. In many places of the world, people can't drink milk in light of the fact that their body turns off the intestinal creation of lactase, a chemical that processes the sugar in the milk.

Answer:

Natural selection is still influencing the evolution of a wide variety of human traits, from when people start having children to their body mass index, reports a study published Monday in the journal Proceedings of the National Academy of Sciences.

Explanation:

Other Questions
An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) slope of 2,11 and 5,2 Hey guys please help!! What is the definition of fourteen points? breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Why did debates among civil rights activists increase after 1965? What were the causes and effects of these debates? (Look into SNCC, CORE, Black Power, and the SCLC, Stokeley Carmichael, Huey Newton &/or Bobby Seale) 1 1 The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please! 2 3/8 x 3 3/4 divided by 2 2/3 HELP PLEASEAt Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event? A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites. B. It provided money to businesses responsible for toxic waste sites to clean up their pollutionC. It helped boost the economy among those waste sites D. It helped identify toxic waste site and move people away from them what do you understand by the term current state and define its SI unit.........