What is the first thing that can cause a change in allele frequency?


1. Large sample size
2. Extremely large sample size
3. Small sample size

Answers

Answer 1
2) extremely large sample size

Related Questions

What do we call a natural resource if it can be used up faster than it can be replaced?

a: depletable
b: renewable
c: sustainable

Answers

Depletable

Renewable is energy we can “renew” or “get back”.

Sustainable is if it “sustains” or works for the present and doesn’t affect the future.

Hope this helps! :)

.......................................................
..........................................................
///////////////////////////

Answers

Answer:

2 2/9

Explanation:

5 x 4/9

20/9

divide 20 by 9

= 2 2/9

Answer:

2[tex]\frac{2}{9}[/tex] is the answer

Explanation:

hope this helps

what is the approximate time of death if the body temperature was 10 degrees celcius

Answers

Answer:

I think it would be 2 to 3 days am so sorry if am wrong

Explanation:

F = c * {9/5} + 32 is the equation

F = 10 * {9/5}

F = 10 * 1.8

F = 18

How many chromosomes should be in each diploid cells after mitosis.

Answers

Answer:

46 chromosomes

Explanation:

46 chromosomes should be in each of these diploid cells after mitosis.

how much water is in our bodies

Answers

Answer:

60%

Explanation:

Water makes up up to 60% of the adult human body. Water makes up 64 percent of the skin, 79 percent of the muscles and kidneys, and even 31 percent of the bones.

I hope this helps you

:)

How are the bodies of the three animals similar to one another? How are they different?

Answers

Answer:

How are animals similar? All animals are made of many cells. Most animals can move on their own. Like all living things, animals grow, change, reproduce, and respond to their environment.

Animals are made up of several cells. Most animals have independent movement. Animals develop, transform, reproduce, and react to their surroundings like all other living creatures do.

What are considered as animals?

Any eukaryotic multicellular organism of the biological kingdom Animalia is referred to as an animal.

The majority of creatures in this kingdom lack a cell wall, are heterotrophic, motile, have specialised sensory organs, and originate from blastulae during embryonic development.

According to some, the fundamental distinctions between humans and other animal species are our capacity for complex reasoning, our use of complex language.

Also, the capacity for problem-solving, and the capacity for introspection (this means describing your own thoughts and feelings).

Multiple cells make up an animal. The majority of animals can move on their own. Like all other living things, animals grow, change, reproduce, and respond to their surroundings.

Thus, this way, many animals contrasts each other.

For more details regarding animals, visit:

https://brainly.com/question/12985710

#SPJ2

Hello people ~
The interspecific interaction in which one partner is benefitted and the other is unaffected (neutral), is called
(a) amensalism
(b) mutualism
(c) competition
(d) commensalism

Answers

Answer:

it is called commensalism

Explanation:

because it benefits one and other derives neither benefit nor harm

Answer:

Commensalism

Explanation:

It is a symbiotic relationship in which one benefitted and the other one is neither benefitted nor harmed..

What are the thin fibers of the human nervous system called?.

Answers

Description of the nervous system
Neurons send signals to other cells through thin fibers called axons, which cause chemicals known as neurotransmitters to be released at junctions called synapses

Answer:

Axons should be your answer.

Explanation:

The individual thin fibers in which neurons send signals to other cells are axons. When individual fibers are bundled together, it is called nerve fiber.

Under what circumstances would a food pyramid be a more useful model than a food chain?

Answers

Answer:

A food chain represents the linear relationship between organisms for food. On the other hand, a food pyramid represents the optimal number of servings to be eaten each day from each of the basic food groups.

Food pyramid represents the total number of food to be eaten each day from each of the basic food groups .A food chain represents the linear relationship between organisms for food.

What is food chain?

Food chain is a linear sequence of organisms through which nutrients and energy pass as one organism eats another.

What is food pyramid?

Food pyramid is a depiction of the optimal number of servings to be eaten each day from each of the basic food groups.

To learn more about Food pyramid , here

https://brainly.com/question/17234521

#SPJ2

A blood sample containing erythrocytes with only surface antigen B on the plasma membrane is ABO blood type ______.

Answers

Answer:

ABO blood type B

Explanation:

The blood sample only contains B as a surface antigen (simplified as the sugars clinging to the blood embedded halfway inside) making any other blood type unviable. B would be the only option.

Purple petal color in pea plants is dominant to white petal color. Two heterozygous pea plants are crossed. What is the ratio of the offspring with white petals to the total number of offspring?

Answers

Answer:

25%

Explanation:

crossing two heterozygous plants would look like this Pp x Pp

making a chart

                      P     p

P              PP        Pp

p             Pp          pp

what this means is that the capital P isdminant so thats what will show is the dominant purple petal whereas lower case p is the ressecive white petal

this means 25% of offspring will be white :)

how do homologous structures show common ancestry?

Answers

Answer:

Homologous structures provide evidence for common ancestry, while analogous structures show that similar selective pressures can produce similar adaptations (beneficial features). Similarities and differences among biological molecules (e.g., in the DNA sequence of genes) can be used to determine species' relatedness.

Explanation:

The correct statement is C. They demonstrate how different species differ and which creature created the structure first. Anatomical characteristics observed in several species that have a common ancestor include what are known as homologous structures.

Although these structures may have diverse purposes in many creatures, their similarities suggest that they had an ancestor.

The anatomical characteristics of several creatures may be compared to find homologous structures and deduce evolutionary links.

Because diverse kinds of creatures have homologous features, it is likely that these qualities were passed down from a common ancestor.

Similarity levels and common anatomical patterns might shed light on a species' evolutionary path.

To know more about Anatomical characteristics:

https://brainly.com/question/32344097

#SPJ2

urgent help would be appreciated

Answers

I think it’s B xxx not sure tho

An organism must have provided all of the following to survive EXCEPT

Answers

Answer:

The answer is the one that is not on this list

List of criteria for a living organism:

1.) Can Reproduce

2.) Goes through homeostasis

3.) Needs Energy

4.) Is organized/ has cells

5.) Grows and Develops

6.) Responds to stimuli.

Explanation:

How is ocean acidification important to the world?

Answers

Answer:

Ocean acidification is already impacting many ocean species, especially organisms like oysters and corals that make hard shells and skeletons by combining calcium and carbonate from seawater.

There was a change in the environment between generations 10 and 30. the change likely .

Answers

These adjustments are in all likelihood genetic mutations evolution is the technique of alternating all existing paperwork from one era to the next and evolutionary biology research how this evolution takes place.

Every era of organisms inherits trends owned via way of means of their mother and father via genes. Changes (known as mutations) in this gene will new trends withinside the offspring of an organism. In an organism's populace, a few trends become greater common, even as others will disappear.This technique is known as herbal selection. The profits of greater offspring than the variety of mother and father at the side of the inheritance.

What are heredity mutations?

Hereditary mutations encompass cystic fibrosis, hemophilia, and sickle mobileular disease. Other mutations can occur on their very own at some stage in a person's existence. These are known as sporadic, spontaneous, or new mutations.

Thus it is well explained.

To learn more about evolution refer to the link :

https://brainly.com/question/1144962

Answer:

✔ favored trait A

Explanation:

An organism has two different possible traits, A and B. A graph of the population is shown right. Which of the following statements is true about Trait B? Check all that apply.

It decreased in frequency over time.

It became extinct.

It is carried on a recessive allele.

There was a change in the environment between generations 10 and 30. The change likely

✔ favored trait A.

The physical appearance of an organism is known as its
A. genotype
B. phenotype
C. allele
D. testcross

Answers

Answer:

B.Phenotype

Explanation:

The term "phenotype" refers to the observable physical properties of an organism; these include the organism's appearance, development, and behavior. An organism's phenotype is determined by its genotype, which is the set of genes the organism carries, as well as by environmental influences upon these genes.

Can a cell be an organism on its own

Answers

Conclusion. Cells are the smallest common denominator of life. Some cells are organisms unto themselves; others are part of multicellular organisms. All cells are made from the same major classes of organic molecules: nucleic acids, proteins, carbohydrates, and lipids.

nah cant

Explanation:

cuz and organisms definition is:

an individual animal, plant, or single-celled life form.

SINGLE-celled life form meaning all the cells are the same

hope this helps :D

In what phase of meiosis does crossing-over take place? why is crossing over important?.

Answers

Answer:

prophase I

Explanation:

This is important because it increases genetic variation.

hope this helps

pls mark brainliest

When two protein chains combine to form an active protein, the structural level is ________

Answers

When two protein chains combine to form an active protein, the structural level is quaternary.

What is a quaternary structure?

The quaternary and tertiary structure of a protein is the tridimensional shape of the protein, which involves protein domains.

The quaternary protein structure refers to the different arrangements generated by different protein subunits.

The primary structure of a protein involves its amino acid sequence, whereas the second structure involves protein chains.

Learn more about quaternary structure here:

https://brainly.com/question/5286438

When two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

What do you mean by Proteins?

Proteins may be defined as naturally emerging, extremely intricate substances that comprise amino acid residues joined by peptide bonds.

The Quaternary structure of a protein is very complex and 3-dimensional as compared to other protein structures which involve numerous motifs and domains.

Therefore, when two protein chains combine to form an active protein, the structural level is the quaternary arrangement.

To learn more about Protein structures, refer to the link:

https://brainly.com/question/14207491

#SPJ4

18 The size of a mouse population in a natural
ecosystem tends to remain relatively constant due to
A. the cycling of energy.
B. the lack of natural predators.
C. the increased numbers of decomposers.
D. the carrying capacity of the environment.

Answers

Answer:

D- the carrying capacity of the environment.

Explanation:

The limiting factors also called as the carrying capacity of the environment keeps the size of a mouse population in a natural ecosystem constant. Therefore, option (D) is correct.

What is a limiting factor in a ecosystem?

Limiting factors are physical, biological, and ecological conditions that:

(1)  Limit the ecosystem's ability to sustain native plant and animal populations and to accommodate natural disturbances like floods;

(2) Limit the quality or availability of habitat that supports all life stages of  native species; and

(3)  Limit the ecosystem's ability to sustain the local tribal culture.

The only natural factor limiting the number of mice in the home is a scarcity of resources such as food. Therefore, The limiting factors also called as the carrying capacity of the environment keeps the size of a mouse population in a natural ecosystem constant.

Learn more about carrying capacity, here:

https://brainly.com/question/2375972

#SPJ2

where is the digestive and circulatory system connected?
a. alveoil
b. villi
c. artery
d. pancreas​

Answers

Answer:

The products of the digestive system are actually tied directly to the circulatory system in that the organs of the digestive system are used to turn ingested food into products that can be absorbed by the blood and then carried to other organs for use as energy or other functions.

Explanation:

Answer:

b) Villi

Explanation:

The digestive and circulatory system is connected by villi.

It is the tiny finger-like projections that line inside of small intestine. Therefore, option (b) is the answer.

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Answers

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

What makes erythrocytes unique from other cellular components of the blood?.

Answers

Answer:They contain hemoglobin.

Explanation:

In a population of pea plants such as the one below, bees and other pollinators prefer to land on purple colored flowers. Over generations, more and more purple flowers successfully reproduce due to this pollinator preference. Which of the following statements accurately describes what is happening to the pea plants over time?



Question 2 options:

Natural selection causes evolution in the population of pea plants and leads to increased overall variation.


Natural selection causes evolution of individual pea plants and leads to increased overall variation.


Natural selection causes evolution in the population of pea plants and leads to an increase in favorable adaptations.


Natural selection causes evolution of individual pea plants and leads to an increase in favorable adaptations.

Answers

Answer:

Natural selection causes evolution in the population of pea plants and leads to an increase in favorable adaptations.

Explanation:

The flowers will evolve to keep that purple trait in order to continue their population growth, hence why it is not individual evolution but as a population. Also since the purple color is a favorable trait it will lead to an increase in favorable adaptations and will decrease variation.

The structural and functional units of the kidney are called

Answers

Answer:

The structural and functional units of the kidney are called nephron.

Fun Facts about Nephron:

Nephron is the structural and functional unit of the kidney.

Its primary purpose is to maintain the concentration of water and soluble chemicals such as sodium salts in the blood by filtering it, reabsorbing what is needed, and excreting the excess as urine.

The glomerulus and renal (kidney) tubule are the two primary structures in each nephron. Each human kidney contains around 1,000,000 nephrons.

The structural and functional units of the kidney are called the nephrons. Each human kidney contains 8-10 lakhs nephrons.

What do you mean by Kidney?

A Kidney may be defined as a pair of bean-shaped organs that eliminate waste and extra water from the blood and help keep chemicals balanced in the body.

Each nephron contains two structures i.e. Glomerulus and Tubules. The Glomerulus is a tough capillary through which a large amount of fluid is filtered from the blood.

Tubules are the other structure of the nephron in which the filtered fluid is converted into the urine.

Therefore, the structural and functional units of the kidney are called nephrons.

To learn more about Nephron, refer to the link:

https://brainly.com/question/832244

#SPJ4

Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel is called __________ vascular catheterization.

Answers

It is called central vascular catheterization

Importance of catheterization

Catheterization is defined as the use of medical devices that can be inserted into the body and used for different medical purposes.

Vascular catheterization is a peripheral catheterization that is used to detect certain upper and lower peripheral extremity conditions.

There are different types of vascular catheterization which include:

Arteriovenous (AV) fistula,

Arteriovenous (AV) graft and

Central venous catheter (CVC)

Central vascular catheterization involves Introducing a vascular catheter directly into a vessel without further advancement past the punctured vessel.

Learn more about catheterization here:

https://brainly.com/question/3911876

A rural, forested area receives a lot of rain in a short amount of time. What would most likely cause potential flooding in the area?

Answers

The most likely cause potential flooding in the area will be saturation of the ground with water.

What is Flooding?

This is defined as a situation in which an overflow of water submerges land that is usually dry.

When the ground is already saturated with water, a forested area receiving a lot of rain in a short amount of time will lead to flooding.

Read more about Flooding here https://brainly.com/question/12686086

How is gravity simulated on the hermes spacecraft?.

Answers

Answer:

A section of the spacecraft is slowly rotated in order to simulate the force of gravity.

Explanation:

The rotational force of the spacecraft makes an artificial sort of gravity, which can be altered by changing the speed of the spinning or by moving the rotating part further/closer to the center point of rotation.

Which of the following best explains why deforestation increases the risk of floods in an area? a. Tree leaves catch and retain rain water. B. Trees block the free flow of water. C. Deforestation increases precipitation. D. Tree roots improve soil water retention. Please select the best answer from the choices provided A B C D.

Answers

Tree roots improve soil water retention

Deforestation increases the risk of floods in an area tree roots improve soil water retention.

Why does deforestation result in higher flood risk?

When deforestation takes place, the top layer of soil can be dislodged – this is also known as soil erosion.

When the top layer of soil is unstable, it is unable to retain any of the water that falls on it, resulting in increased surface run-off, which, in turn, increases the risk of flooding.

Thus, option "D" is correct.

To learn more about deforestation click here:

https://brainly.com/question/17178423

Other Questions
Dalton developed a phobia of dogs after watching his older cousin act fearfully when he interacted with dogs in their neighborhood. Which of the following best explains why dalton developed his phobia of dogs?. You are looking at a specimen under the microscope, what would you use to adjust the light being focused in on the slide?. Producer c has written 25 policies over the last 12 months, 4 of which have been issued to his employees in a side business, accounting for 24% of total premiums for the year. this is an example of what unfair trade practice? Who were julius and ethel rosenberg? russians who stole american space exploration technologies americans who were blacklisted for being suspected communists americans accused of stealing national secrets and spying for the ussr russians accused of working as spies for the united states Based on paragraph 3 ("in a different. . . Augustine"), what can most reasonably be inferred about augustine? A pregnant womans use of cocaine or methamphetamines increases the risk to her fetus of all of the following EXCEPT obesity. low birth weight. miscarriage. For a closed economy, gdp is $12 trillion, consumption is $7 trillion, taxes net of transfers are $3 trillion and the government runs a deficit of $1 trillion. What are private saving and national saving?. adapted from Penrod by Booth Tarkington match the statements NEED HELP PLEASE1. Explain why celebrity endorsements are risky agreements for companies.2. Why do you think the FTC creates laws governing celebrity endorsements? To whom do these laws benefit? Why do historians call the people who served in world war ii the greatest generation?. Convert 191% to a decimal. Melissa uses laxatives in an attempt to lose some of the weight she gained from binge eating. Melissa most clearly demonstrates symptoms of:. in the small intestine, which of the following enzymes breaks down oligosaccharides? According to the observations made by Washington Matthews, the reciting of a song like Twelfth Song of Thunder often gave the Navajo peoplethe guarantee of a rich and plentiful harvest in the spring.the opportunity to discuss their spiritual beliefs with others.the occasion to have a celebration during difficult times.the chance to come together and enjoy each others company. What is your experimental probability for rolling at least one 1 when rolling two dice? SHOW YOUR WORK please(: A customer must choose a color of wrapping paper and gift box type for gift wrapping at a store. The table shows the customers options.Wrapping Paper Color red (R)silver (S)yellow (Y)Gift Box Typeregular (G)premium (P)Which list shows the complete sample space of choosing a wrapping paper color and gift box for the gift?A)GR, GS, GP, GYB)PG, PR, PS, PYC)RG, RP, RS, SG, SP, YG, YP, YR, YSD)RG, RP, SG, SP, YG, YP the following shape has 1 pair of parallel sides 2, 7, 3, 8 Which set of directions correctly describes how to plot the point (5, 7) on the coordinate plane?1) Start at the origin. Move 5 units up, then move 7 units to the right.2)Start at the origin. Move 5 units up, then move 7 units to the left.3)Start at the origin. Move 5 units to the right, then move 7 units up.4)Start at the origin. Move 5 units to the left, then move 7 units up. Candice has already taken 5 pictures at home, and she expects to take 1 picture during every day of vacation. How many days will Candice have to spend on vacation before she will have taken 7 pictures? what are courts often involved in cases concerning eminent domain Steam Workshop Downloader