what is the difference between climate and wheather

Answers

Answer 1

Answer:

Weather reflects short-term conditions of the atmosphere while climate is the average daily weather for an extended period of time at a certain location.

:P


Related Questions

Any one free
InboX me (◍•ᴗ•◍)❤​

Answers

Answer:

hiii

Explanation:

how does Pteromyzon differ from scolidon and labeo fishes?
who answer this question in 10 seconds I'll mark his or her ans. as "BRAINLIST ANSWER"
It's my promise but the answer must not be copied from internet​

Answers

Answer:

Due to no jaws, no paired fins and scales on the body.

Explanation:

Pteromyzon fish is different from scolidon and labeo fishes because Pteromyzon fish is not a true fish. The main reason for this is that Pteromyzon fish is agnathous means having no jaws and it doesn't have paired fins and scales on their body while all these features are present on the body of  scolidon and labeo fishes so we can conclude from this discussion that Pteromyzon fish is different from scolidon and labeo fishes.

Why are bananas curved?

Answers

Answer:

It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.

Explanation:

g.o.o.g.l.e lma o

Answer

It's because of the sun!

Explanation:

Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

What are the like terms in the expression: 2a + 3b+ 40 - 5a + 8 - 4
O 2,3,4,-5
O 2a, 3b, 4c
O-5a, 8
O2a, -5a, 8, -4


i need help plzz

Answers

Answer: 2,3,4,-5

Explanation:

it seems that 40 is supposed to be 4c.

the terms can be grouped in several ways

2a, -5a                   Contain factor ‘a’

8, -4.                Simple integers/constants

2a, 4c,  8, -4.          Even numbers

2a, 3b, 4c,  -5a       Contain a factor      

Can’t group on + or - because values of a,b,c are unknown

From the available choices, only 2,3,4,-5 matches a logical group.

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

Do all plants respond the same to all abiotic factors?

Answers

Answer:

Light intensity: limited light will limit photosynthesis. This will affect the distribution of plants, and therefore the distribution of animals that eat plants. ... Temperature: temperature is a limiting factor for photosynthesis - and low temperature therefore limits growth of plants.

Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?

Answers

The name of the gas is t

What is the main function of the smooth and rough Endoplasmic Reticulum in a cell?

Answers

Answer:

Smooth endoplasmic reticulum provides vesicles for the Golgi apparatus whereas rough endoplasmic reticulum provides biochemical for the Golgi apparatus. Both smooth and rough endoplasmic reticulum helps in the synthesis and storage of proteins.

Hope this helped!

Name the features caused by wave erosion and label them in the order that they would
occur. Write a short description of each feature.
Hint. There are 6 features.

Answers

Caves

Sea cliffs, sea stacks, sea caves, sea arches, handlands, and wave-cut terraces.

one is missing but u can just check it on quizlet

Fill in the blank: ______ is the process that splits rock when water seeps into cracks, then freezes and expands.
YES I WILL HAVE A LOT OF FILL IN THE BLANK GET READY

Answers

Answer:

Freeze-thaw

Explanation:

Answer:

frost wedging

Explanation:

why does the temp of the air increase with the height of the stratosphere?

Answers

Answer:

The hot air rises and the cool air falls

Explanation:

Which of the following below, best describes a cell from bacteria?
A. A multicellular organism

B. A cell with many organelles

C. Multicellular, Eukaryote

D. Unicellular, prokaryote

Answers

A multicellular organism

In an earthworm is the dorsal blood vessel or the ventral blood vessel larger?

Answers

Answer:

Dorsal lol, its contracts and pumps blood to the aortic arches.

Would you expect the stomata of a desert cactus or the stomata of a water lily plant to close during the day?

Answers

A water lily will have more stomata. A desert cactus will have very few stomata, because in deserts plants face water shortage so in order to avoid loss of water cacti have adapted to the desert environment by possessing few stomata.

The stomata of a desert cactus will close during the day.

STOMATA:

The stomata (singular- stoma) are structures on the leaves of a plant that helps in gaseous exchange i.e. entry and exit of CO2 and O2 gases.

The stomata, however, when opened allows the passage of water vapor from the plant. Hence, plants utilize the opening and closing of stomata to regulate water loss.

Desert cactus is a xerophytic plant meaning that they can survive in low water conditions. One way they adapt to their desert environment, which is characterized by low humidity, is by the closure of their stomata during the day.

Therefore, the stomata of a desert cactus will close during the day.

Learn more at: https://brainly.com/question/3387375?referrer=searchResults

The chemical equation for cellular respiration is:

glucose + oxygen ----> your mama

carbon dioxide + water
sunlight --->glucose + oxygen

oxygen + carbon dioxide glucose + water

glucose + oxygen --->carbon dioxide + water + ATP (energy)

Answers

Answer: The last one

Explanation:

Glucose+oxygen----> Carbon dioxide+ water+ ATP(energy)

what is the meaning of biosphere​

Answers

Answer:

The biosphere is a global ecosystem composed of living organisms (biota) and the abiotic (nonliving) factors from which they derive energy and nutrients. Earth's environmental spheres. Earth's environment includes the atmosphere, the hydrosphere, the lithosphere, and the biosphere.

Explanation:

''.''

Biosphere, relatively thin life-supporting stratum of Earth's surface, extending from a few kilometres into the atmosphere to the deep-sea vents of the ocean. The biosphere is a global ecosystem composed of living organisms (biota) and the abiotic (nonliving) factors from which they derive energy and nutrients.

Combined sewage overflow has been linked to eutrophication in ecosystems within NYC, including Jamaica Bay and Coney Island Creek. Based on your understanding of eutrophication, why might combined sewage overflow be causing an overgrowth of harmful algae in NYC? Explain your answer in YOUR OWN WORDS please.

(This is 7th grade science).

Answers

like your name

Explanation:

Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?​

Answers

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

You want to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%). How much of each will he have to mix together? Show your work for full credit.

Answers

Answer:

To make a 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%), 0.6 tons of soybean meal and 0.4 tons of corn are needed

Explanation:

Using the Pearson’s Square calculations:

1. Subtract across the diagonal:

a. 18% - 12% = 6 parts soybean meal

b. 18% - 22% = 4 parts corn

2. Sum the parts:

a. 6 parts soybean meal + 4 parts corn = 10 totalparts

3. Divide each part by the total to calculate the percentage of each feed to include in the ration:

a. 6 parts soybean meal ÷ 10 total parts * 100 = 60.0% soybean meal

b. 4 parts corn ÷ 10 total parts * 100 = 40.0% corn

So, to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%),

60% of soybean meal is needed = 60/100 * 1 ton = 0.6 tons of soybean meal

40% of corn is needed = 40/100 * 1 ton = 0.4 tons of corn

The process by which modern organisms have descended from ancient organisms

Answers

I believe it is called evolution and you can see this with a genetics tree

Answer:

evolution, or change over time

Explanation:

January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?

Answers

This is because the frequency of of a wave is a number of repeating event per unit time.

What is Pedigree?? Can someone help me i need this answer plzzzzzz

Answers

Answer:

A pedigree is like a lineage or a recorded ancestry. For example, if a dog has recorded breeding papers it would show you it's pedigree. I hope that helped! :)

Plz help me its only 1 question

Answers

Answer:

the first one

Explanation:

the car slowly started and accelerated

Its the second one. Since its continually accelerating.

Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil

Answers

Answer:

B)Magma

Explanation:

23. Which of the below names is not a type of biologist?
a) paleontologist
b) botanist
I
c) zoologist
d) astrophysicist
BA

Answers

Answer:

D

explanation: it literally has physics in its name

When do you think the rays of the sun encounter particles

Answers

All of the energy from the Sun that reaches the Earth arrives as solar radiation, part of a large collection of energy called the electromagnetic radiation spectrum. Solar radiation includes visible light, ultraviolet light, infrared, radio waves, X-rays, and gamma rays.

Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.​

Answers

Answer:

a. The ability to cure genetic diseases by replacing defective genes

Explanation:

Which plant propagation process insures some genetic diversity?

Answers

Answer:

Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.

Explanation:        

Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.  

Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.

Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.

70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.

Answers

Answer:

can I write an essay

Explanation:

On April 20, 1902, Marie and Curie with success isolate radioactive  metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic  radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.

Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.

we need a picture ..
Other Questions
The diagram below shows the water cycle What process is shown at point AWhat process is shown at point BWhat process is shown at point C a circle has a diameter of 7.6 feet How many Americans were killed when the USS Maine exploded? What is the order of the problem? Which of the following has zeros that are not significant? 2.05 m/s 10.0 J 1.30 N 100 kg WILL GIVE BRAINLIEST !! Ella needs at least $360 to pay for her spring break expenses and she is saving $25 from each of her weekly paychecks. How long will be before she can pay for her trip? How did the struggles of black women during the Civil Rights Movement compare to the struggles of black men? Why are transitlons Important In wrting? When Is the approprlate time to use transitlon words? Give an example of atleast two different kinds of transitlons. George is putting trim around his rectangular deck, including the gate. He will need 46 feet of trim to do the entire deck. If the deck is 15 feet long, how wide is the deck? A. 6 feet B. 16 feet C. 8 feet D. 23 feet mang pedro has 20 kilogram of rice.he will repack it in 1/2 kilograms per bag.how many bags will he need? Evaluate the following argument after reading the text.Girls and boys should be able to play on the same sports team. When boys and girls in our neighborhood play pick-up football, we treat each other as equals and form great friendships. According to The Sports Journal, many professional women say that they grew up playing sports with boys. Also, studies show that boys become more flexible and nimble when they play with girls on the team.Which sentence needs more of an explanation in order for it to support the claim? (1 point)According to The Sports Journal, many professional women say that they grew up playing sports with boys.When boys and girls in our neighborhood play pick-up football, we treat each other as equals and form great friendships.Girls and boys should be able to play on the same sports team.Also, studies show that boys become more flexible and nimble when they play with girls on the team. hey u plz help me me need help 1. Those who believe that nature trumps nurture in the debate over how we learn are suggesting that.....O Our environment creates pathways that allow us to choose our own destinyO We inherit our behavior genetically from our ancestors.o We leam to model our behavior after our parentsO Experience shapes our behavior A rectangular prism has a length of 9 centimeters, a width of 4 centimeters, and a height of 2 centimeters.What is the volume of the prism? An isosceles triangle has two sides of length n where n is an integer greater than 1. What is the smallest possible integer length of the third side?(1 point)n/2+1n110 Can yall help please Why were colonial minutemen so prepared for the arrival of the British in Concord? SELECT ALL THAT APPLYA. When Washington saw the British, he fired three canon shots sending a warning signal.B. Paul Revere had warned villages that the redcoats were coming.C. The Green Mountain Boys hid in the bushes and warned the Continental Army.D. When the British headed out, Americans hung two lamps as a warning signal. Anaerobes carry on whereas aerobes carry on cellular respiration 200 points down the drain lets see how fast I can get rid of the rest of my 126 points. How bout a 100 point question? Hehe Read this paragraph from Joy Harjo Is the First Native American Poet Laureate."I don't have a defined project right now, but I want to bring the contribution of poetry of the tribal nations to the forefront and include it in the discussion of poetry," says Harjo. She is from Tulsa, Oklahoma. She is also an enrolled member of the Muscogee Creek Nation. She says that the U.S. is "in need of deep healing."How does this paragraph contribute to the development of ideas in the passage?It provides a short biography of Harjo and other poets from Tulsa.It suggests what Harjo's work as a poet laureate might involve.It introduces Harjo's connections with the Native American community.It highlights the problems Harjo sees in modern American culture.