Upon rereading The Story of an Hour you will write a thoughtful and grammatically correct thesis statement that addresses the following prompt.

LITERARY ANALYSIS: How does the author use literary elements to develop the plot of “The Story of an Hour”? In your response, evaluate at least two of the literary elements used by the author and how they shape the plot. Use evidence from the text to support your analysis.

Answers

Answer 1

What does that mean?


Related Questions

Highlight language that appeals to your senses.

But, alas! this kind heart had but a short time to remain such. The fatal poison of irresponsible power was already in her hands, and gradually commenced its infernal work. That cheerful eye, under the influence of slavery, soon became red with rage; that voice made all of sweet accord, changed to one of harsh and horrid discord; and that angelic face gave place to that of a demon.

—Narrative of the Life of Frederick Douglass,
Frederick Douglass

The phrase "that voice made all of sweet accord, changed to one of harsh and horrid discord" appeals to which sense?

sight
touch
smell
hearing

Answers

Answer: Hearing

Explanation: The phrase is talking about voice, which is something that can be heard. Touch, smell and sight are not used in the phrase.

Hope this helps :)

Answer:

hearing

Explanation:

took the test got it right!


3) As used in paragraph 2, which is the best antonym for complex?
A. impressive
B. beautiful
C. exciting
D. simple

Answers

Answer:

D. simple

Explanation:

As used in paragraph 2, the best antonym for complex is simple.

Complex is known to be a system of different things which are linked or connected in a close or complicated way. Antonym means the opposite of something. So, the opposite of complex as used in paragraph 2 is "simple".

From the passage, the narrator further explained why he said the Ferris Wheel is complex. He revealed that the way the wheel works is complicated. So, the antonym is simple. Option D is correct answer.

Hinman argues that what is morally significant about this story is not just what the villagers did but what kind of people they were, what kind of character they had.

A) False

B) True

Answers

Answer:

This is TRUE.

Explanation:

Let's take a look at the passage where Hinman speaks of the villagers from Le Chambon:

When we look at the villagers of Le Chambon, we are not only struck by  what they did but also by who they were. We are struck by what good people  they were. Their goodness did not seem to stem from any Kantian test of  universality or utilitarian calculus of consequences. It came from the heart—  from who they were as persons.

The villagers he is speaking of were responsible for saving the lives of thousands of Jews when Nazism was terrorizing Europe. When the Nazi soldiers got hold of one man, the villagers surrounded the bus where he was sitting and gave him precious, rationed food. When he returned and tried to give them their gifts back, they wouldn't accept it. Their actions, according to Hinman, had no purpose or gain for themselves. They did what they did simply because they were good people, because they had goodness in their hearts.

What do you think? Are you in favor of more gun control or less AND why? (3 sentences
In my personal opinion I think we should have gun control as there are too many crazy people out there and like TW; school shootings: but what do you think?

Answers

Answer: I am in favor of more gun control.

Explanation: If we look back on our history of school shootings and mass murders, the guilty are very young. Having access to weapons at such a young age assists in the bad decision making of young, underdeveloped minds. I also think it would provide very necessary change in lower income/minority communities. I think gun violence in these communities would decrease immencely with stricter gun laws. (I personally lost one of my parents, a cousin, and a few friends to gun violence so I feel pretty strongly about this subject.)

Good luck! :)

PLEASE HELP!!! What is the shared purpose in both, "I Will Fight No More Forever" and "The School Days of an Indian Girl"?

Question 5 options:

A. To persuade readers to read more Native American literature.


B. To inform readers about the perspectives of 19th century Native Americans.


C. To persuade readers that Native Americans should not have been educated.


D. To inform readers of the positive outcomes of Western education of Native Americans.

Answers

Answer:

To inform readers about the perspectives of 19th century Native Americans.

Explanation:

Prose contains all of the following literary elements, except:
A dramatic monologues
B repetition
C descriptive language
D imagery

Answers

Answer: its C trust me my mom was a teacher

Which best describes the difference in these two passages?

A) The first passage claims that recycling is a waste of money, but the second passage argues that recycling is a worthy activity.
B) The first passage argues for River Elementary to start a new recycling program, while the second passage lists all the the different items that can be recycled.
C) The first passage argues that River Elementary needs a recycling program, while the second passage claims that now is not the time for River Elementary to start a new program.
D) The first passage argues that River Elementary does not need a recycling program, while the second passage argues that a recycling program for River Elementary is needed immediately.

Answers

Answer:

I'm going to say B, but I am not completely sure. If this is wrong, than I advise you go go over C too.

Explanation:

I tried my best and I hope this helps you.

Answer:

C): The first passage argues that River Elementary needs a recycling program, while the second passage claims that now is not the time for River Elementary to start a new program.

• Reread the story and focus on details about the culture or setting.
• Learn more about the culture or setting of the story by doing research. Gather information from at least three electronic sources.
• For your search terms, use specific cultural or local details that you find in the story, as well as the name of the culture or setting. For example, if the setting is the Iditarod dogsled race in Alaska, search for “Iditarod” or “dogsled race” rather than just “Alaska.”
• Integrate information from your research smoothly to create a clear and cohesive text that readers will appreciate.
• Paraphrase, summarize or quote content from your sources.
• At the end of your assignment, include a list of the URLs of the websites from which you gathered information.
When you have finished, submit this document to your teacher for grading.

Answers

Answer:

I know a story called hatchet i am not sure if you heard of it before you can try to do you homework based on this story??

Explanation:

How many men did it take to capture Antigone?

A:2
B:5
C:1
D:7

Answers

Answer:

B.5

Explanation:

Answer:

It was actually 53 men

Explanation:

It is found that only 5 men came to fight him but 53 men were sent to capture Antigone.

in Macbeth act 2, how is the murder of the king discovered?

Answers

Answer:

Macduff because he had an appointment to meet with King Duncan but, ended up finding the King's dead body instead.

Explanation:

Hope this helps!

Why is Nya so confused about the visitors? (text evidence)

Answers

She doesn’t know why they would be here, that’s why she’s so confused

Part A

What is the central idea in the Newsela article "Joseph Campbell and the Hero's Journey"?


Campbell found that many stories have a similar structure.

Story analysts study heroes in blockbuster films.

Good storytellers read Campbell's work to develop strong characters.

Screenwriters adapt the monomyth model in films today.
Question 2
Part B

Which quote best supports the answer to Part A?


"The monomyth is the typical path a story takes, across all cultures and religions."

"A hero leaves the ordinary world and ventures into a region of magic and wonder."

"In the early 1990s, screenwriting author Christopher Vogler studied Campbell's work at the University of Southern California."

"The next time you tell a story, think about the way you are telling it and why."

Answers

Answer:

Part A: Campbell found that many stories have a similar structure

Part B: The next time you tell a story, think about the way you are telling it and why.

Explanation: I took the 6th grade K-12 quiz and thats what it said the answer for the Mythology 2 test is. yw

Read the sentence.

The Tower of London dates back to the year 1066, is from the same era as Buckingham Palace, is older than Westminster Abbey, and is one of the oldest historical sites in England.

Which noun is modified by the underlined phrase?

the Tower of London
the year 1066
Buckingham Palace
England

Answers

Answer:

The Tower of London

Explanation:

The underlined phrase in the given sentence is is older than Westminster Abbey The noun phrase that is modified (described) by it is the Tower of London.

A noun phrase is a group of words that contains a noun and functions like one. This means that it can function as the subject, object of a verb, object of a preposition, or a complement within a sentence. The main noun in the given phrase is Tower, and this is why we could say that Tower is the noun modified by the underlined phrase.

Answer:

A) Tower Of London

Explanation:

Trust the process

edge 2021

3. Answer the following questions.
a. Who was Bhungi? Would you say she was content with her lol?​

Answers

Answer:

a Hindu scavenger who belongs to one of the untouchable castes

help me I’m about to have a meantal break down

Answers

I think the answer is C

what is the reader opinion, and which evidence BEST supports it?

Answers

Answer:

The answer is B.

Explanation:

It is a true statement, backed up with reasonable, and correct, evidence.

which is NOT an important function of context in a news story?!?
To help readers understand the topics significance
To make readers understand the topic
To change readers’ minds about an issue
To provide a clear, vivid picture of events

Answers

Answer:

b

Explanation:

To change readers’ minds about an issue is not an important function of context in a news story. The appropriate response is option C.

What is context in a news story?

When a writer provides context, such as the history that led to the event, comparison to similar incidents, connection between these players and the outside parties, and responsible predictions of what will happen next.

a set of facts about some event that happened today takes on much more meaning—and accuracy even—than when the writer simply presents the facts.

The intended message is made clear and meaningful by context. Contextual hints in a literary work foster a connection between the author and reader and provide a deeper understanding of the writing's purpose and direction.

To learn more about context

https://brainly.com/question/10943525

#SPJ2

which is the best explanation of how the setting helps reveal the theme

Answers

Answer:

if it were me i would say A

Explanation:

Please help me with this

Answers

Answer:

which number a or b or c or d or f or e

Explanation:

Question 5 (1 point)
The class (respect, respects) the views of the professor.
respect

respects

Answers

Answer: B. respects

Explanation: The class respects the views of the professor. This is the correct sentence for fixing the grammar.

I hope you have a great day! ^-^

Eleanor Roosevelt said that Anne Frank's story made her "intimately and shockingly aware of war's greatest evil—the degradation of the human spirit. At the same time, Anne's diary makes clear the ultimate shining nobility of that spirit." In two paragraphs (three to five sentences per paragraph), explain how Anne Frank's story shows the misery and indignity that war causes, but also the goodness of the human spirit.

Answers

Answer:

Anne Frank is a story that shows how cruel a person can truly be. It shows the evil that was preformed by the Hitler was towards Jewish people, even a little girl like Anne was taught she was less than Germans because of her heritage. She knew and had to live with how awful other Jewish people, even people she knew, were treated. How they were killed and abused, though that may be an understatement. Though her story shows the of cruelty, it also shows how good and generous a person can be. Miep Gies put her own safety on the line to help protect not only the Frank family, but also the Van Pel family and Fritz Pfeffer. She kept them safe as best as she could for as long as she could. Even in a time where most people would turn their backs on people in need and only think about themselves. Not only that, but Anne and her famil remained good and loving people which seems almost impossible given the circumstances they were living in. On two very different sides of the spectrum, a person can be truly evil and vile. On the other end, a person can be good and loving and generous.

Explanation:

Hope this helps!

Mayella Ewell lies on the witness stand out of fear for her father Bob Ewell and embarrassment over her attraction to Tom Robinson. She claims to the jury that Tom beat and assaulted her, but her father actually beat her after he caught her cuddling and kissing an African American.

What is an attraction?

The term "attraction" refers to an emotional, romantic, physical, or aesthetic interest, desire, or affinity. A lot of individuals think that attraction is only romantic. But many emotions—including being interested in someone, praising their attractiveness, and having sexual feelings—qualify as an attraction.

The majority of people are primarily impacted by someone's physical appearance before becoming more or less attracted to someone over time depending on other criteria, such as likeness, personality, and reciprocal interest.

She was aware of the horrendous treatment that other Jews, including individuals she knew, received and had to live with it. Though it might be an understatement, how they were murdered and mistreated. Her tale demonstrates harshness, but it also demonstrates the goodness and generosity of others.

Therefore, Ewell and embarrassed over her attraction to Tom Robinson.

Learn more about the attraction here:

https://brainly.com/question/497462

#SPJ2


Which line from the drama best supports the idea that Jacob likes to prepare in advance?

A. "Just because you like to do things differently doesn't mean I'm wrong."

B. "Yes, Mom. I don't want to be busy doing my homework when Cassie arrives."

C. "We learned how to make hot ice in science class today, and it was awesome!"

D. "Hey, Liam how about I help you with the chores so that you can get done faster?"

Answers

Imma say c??? I hope I helped

In Scene 6, has Scrooge come to understand the true spirit of Christmas? *

a.No, he doesn't learn any lessons and plans to keep living his life as before.
b.Yes, he plans to sell everything he has and work in the poorhouse.
c.Yes, he sees his past errors and plans to keep the spirit of generosity and charity in his heart year round.
d.Yes, he sees some of his errors and plans to give to others only at Christmas time.

Answers

Answer:

pls answer meeeeeee

Explanation:

love u

What qualities enable people to perform well when facing heart- pounding fear or stress? Think about your own experiences or those of someone you know, as well as news stories or fiction you’re read. Then, jot down your thoughts about people taking action when the stakes are high

Answers

Answer:

Qualities enable people to perform well when facing heart- pounding fear or stress is discussed below in complete details.

Explanation:

Qualities that empower people to function well when facing heart-pounding fear or stress is the capability to calm down. The capability to calm down and consider within what you are agreeing to do, but also do it within a short quantity of time. The most essential quality is being capable to think quick, clear, and not do anything unreasonable.

At the police station, after Starr details the events leading up to the shooting, the detective shifts her focus to Khalil's possible drug and gang activity. Why do you think he did this? Discuss Starr's reaction to the "bait."

Answers

Answer and Explanation:

1. The policeman tries to change the focus of the crime that happened. He looks for a way to get Star to display information that allows him to modify what really happened about Khalil's death and put him as the culprit in the story, with Khalil being killed by a racist police officer who used the abuse of authority to do this. .

2. Star doesn't fall for the bait and even though she knows that Khalil was involved in the drug trade, she knows that his murder had nothing to do with it and that he was murdered unfairly, due to the abuse of power and violence police against blacks.

why does odysseus not want to talk to his mother?

Answers

Answer:Hover for more information. This is actually in Book XI (not XII). Odysseus cannot hug her, no matter how much he wants to, for his mother is now a "shade," living in Hades. There is a division between flesh and spirit that cannot be connected.

Explanation:

Answer:

it's not in my syllabus

sorry!!!

Explanation:

bye

change the statement given below into a question beginning with: "will..." "we will meet again."​

Answers

Answer: “Will we meet again?”

Answer:

Please the answer is will we meet again?

Explanation:

The question mark is because we are being interrogative

THANK YOU.

Why do these things always happen to me?, Brad wondered. First I forget an important meeting, and nobody reminds me until it's over. Then my boss dumps a big project on my desk and wants it done by yesterday. And to top everything off, I leave my wallet on the bus.

Answers

I've looked this question up, and it is about finding the tone of the passage. It is incomplete here, missing the options. They are the following:

1. comic - amusing you and making you want to laugh

2. optimistic - believing that good things will happen in the future

3. self-pitying - the feeling of being sad and depressed because you think that something unfair or unpleasant has happened to you - used to show disapproval.

Answer:

The correct tone for the passage is:

3. self-pitying - the feeling of being sad and depressed because you think that something unfair or unpleasant has happened to you - used to show disapproval.

Explanation:

The tone is an attitude the author takes toward his or her subject, characters, and readers. It conveys emotions or sensations - happy, dreamy, melancholy etc.

In the passage we are analyzing here, the tone is one of self-pity. The speaker feels sorry for himself, for the bad and unjust things that have taken place. He is basically complaining throughout the passage, and the question "Why do these things always happen to me?" shows he sees himself as a victim.

The correct tone for the passage is:

3. Self-pitying

Depression

The correct tone for the passage is Self-pitying.

The feeling of being pitiful and discouraged since you think that something unjustifiable or unsavory has happened to you - utilized to appear disapproval.

It passes on feelings or sensations the upbeat, marvelous, despairing etc.

Learn more about "collocation":

https://brainly.com/question/26138521?referrer=searchResults

The Question is incomplete the followings are :

1. Comic

2. Optimistic

3. Self-pitying

Anxiety is an _________________, feeling of dread, much like fear . (fill in the blank)

Answers

Answer:

Anxiety is a feeling of dread

Explanation:

Directly defined Anxiety is a A feeling of worry, nervousness, or unease, typically about an imminent event or something with an uncertain outcome

After working in the garden, Vinny washed her hands with an antiseptic liquid soap.

What is the meaning of the prefix in the word antiseptic?

Answers

Answer:

anti means against

Explanation:

pre means before, anti means against

Other Questions
SOMEONE, PLEASE HELP LITERALLY STRUGGLING!!!!!! Circle 1 represents students involved with drama after school, circle 2 represents students involved in sports, and circle 3 represents students in academic club activities. What can you conclude about students who fit in region B?A.Region B represents the students involved in sports only.B.Region B represents the students involved in sports and academic clubs.C.Region B represents the students involved in drama and sports.D.Region B represents the students not involved in academic clubs.Please select the best answer from the choices providedABCD Who became the first governor to be inaugurated in the New Capitol in 1904? 1. How did Jeannette catch on fire in the beginning of the novel? *1 pointa. She was making herself pasta while Rose Mary watched and painted.b. She was testing chemical reactions with toxic chemicals in a shed near her house.c. She was throwing toilet paper that was on fire down the toilet.d. She was cooking hot dogs by herself. 3Which statement below best completes the chart?Water shortages occurred as more people moved to rural areas4Air pollution levels increased as governments eased regulationsCities grew in size as previously used farmland was absorbed by rural areas5Cropland eroded as farmers used outdated technique Joe would have earned $504 for working a 42 hour week but he was sick and missed 4 hours. How much did he earn? Help asap please!! I will mark you as brainliest :) As a discipline, Governance is most closely related to: Help plzzzzzzzzzzzz 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education