True or False.
The lymphatic and immune systems contain the lymphatic vessels and ducts, lymph nodes, bone marrow, and spleen.

Answers

Answer 1

Answer:

True

Explanation:

I also like your profile picture

Answer 2

The lymphatic system consists of  lymphatic vessels and ducts, lymph nodes, and spleen. The immune systems consist of bone marrow. Hence, statement true.

What is immune system?

The system that helps to fight infections and diseases with the help complex system of tissues, cells, organs is called as immune system.

In humans, immunity is of 3 types including:

adaptive immunity- natural immunityinnate immunity- develops throughout lifepassive immunity- borrowed from any source that doesn't last long.

Bone marrow and the thymus are primary parts of the immune system. Bone marrow play significant role in production of blood cells including B and T lymphocytes. In also includes organs of lymph system such as lymph node, thymus, spleen, tonsils, lymph node, and lymph vessels.

Therefore, The statement above is true.  

Learn more about immune system, here:

https://brainly.com/question/19843453

#SPJ3


Related Questions

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

How does biology affect behavior?

Answers

Answer:

some behaviors may have a genetic basis, but genes do not actually control behavior. Rather, our genetic makeup influences how we interact with and respond to our surroundings.

Explanation:

There you go

Biology is a normal thing it diesnt really effect us

rko vs claymore who will win​

Answers

Answer:

claymore duh

Explanation:

Answer:

claymore

Explanation:

4 points
The inferred temperature and pressure of Earth's
interior at a depth of 3,000 kilometers are
approximately
(1) 1000°C and 0.5 million atmospheres
(2) 1000°C and 1.0 million atmospheres
(3) 5000°C and 1.5 million atmospheres
(4) 5000°C and 3.0 million atmospheres

Answers

Answer:

(4) 5000°C and 3.0 million atmospheres

Explanation:

The inferred temperature is 5000°C and pressure of Earth's  interior is 3.0 million atmospheres at a depth of 3,000 kilometers. At the depth of 3000 kilometers, core of the earth is present which is very hot and it is mostly consist of iron. The inner core has a radius of about 1,220 kilometers while the outer core is about 1,400 miles thick which comprise of iron, Nickle, gold, platinum, and uranium elements.

MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?

Answers

Answer:

Due to its high intelligence.

Explanation:

Scientists think that cuttlefish  have the biggest brain to body ratio of all  invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.

1) BB x bb (B=Brown, b=blue) 2) Aa x Aa (A=Tall, a=short) 3) DD x Dd (D=Rough,d=smooth) 4) Ee x ee (E=Stripes, e-soild). ? help someone​

Answers

Answer:

1) Brown, 2)Tall with a 25% chance of short 3) Rough 4) 50% chance of solid 50% chance of stripes

Explanation:

The big letters are the dominant. Dominant always shows up if its part of it. The genetic squares show that any square with a Big letter will present the big letters trait. i didnt really understand so i hope this is what you're looking for

A simple life cycle is one in which the offspring look similar to their parents.
True
Or
False

Answers

False — life cycles have to do with birth to death progressions, not genetic traits.

What is a constant?
O a variable
a number that stands alone with no variable
O the number in front of the variable
O two terms that look exactly the same


need help please

Answers

Answer:

a number that stands alone with no variable

Hope this helps!

Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​

Answers

Answer:

40kg

Explanation:

F=M*A

M=F\A

M=400\10

M=40kg

The mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​ is 40 kg.

What is acceleration due to gravity?

The net acceleration that objects get as a result of the combined action of gravity and centrifugal force is known as the Earth's gravity, or g.

It is a vector quantity whose direction, strength, or magnitude match a plumb bob.

According to Newton's second law, an object's acceleration is inversely proportional to its mass and directly connected to the net force. An object's acceleration is determined by two factors: force and mass.

We know that,

F = m x g

m = f/g

Where,

F = force

m = mass

g = acceleration due to gravity

Given that,

F = 400N.

g = [tex]10m/s^2[/tex]

So,

m = 400/10

m = 40 kg.

Thus, the mass is 40 kg.

For more details regarding acceleration due to gravity, visit:

https://brainly.com/question/13860566

#SPJ6

What determines which bases will be brought to the DNA strand during DNA replication?

Answers

Answer:
Replication relies on complementary base pairing, that is the principle explained by Chargaff's rules: adenine (A) always bonds with thymine (T) and cytosine (C) always bonds with guanine (G).

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

explain in details the mechanism of transportation in plants​

Answers

Answer:

Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.

Explanation:

I hope I helped:)

Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?

Answers

Answer:

Abnormally high temperature

Explanation:

Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.

When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

What changes occur to the ratio of surface area to volume as a cell
grows?

Answers

Answer:

As a cell grows, its surface area-to-volume ratio decreases

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

What is the definition of a DNA Polymerase

A. Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule
B. An enzyme that unwinds the DNA double helix during DNA replication
C. A class of nucleotides that includes adenine and guanine.
D. A bond between complimentary base pairs in DNA​

Answers

A. I hope this hopes

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

Which statement is part of the cell theory?
A Single-celled organisms are made of one cell.
B Cells are different in size and shape.
C All cells come from other living cells.
D Cells sometimes only have one job.

Answers

Answer:

I believe it's C, all cells come from other living cells.

In mature animals when do cells still need to differentiate?

Answers

Answer:

As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.

Explanation:

''.''

In mature animals cells differentiate during : Repair and replacement of  animal cells

Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.

While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.

Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.

Learn more : https://brainly.com/question/19015367

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

Can someone please help me I don't understand the and my parents don't under please

Answers

432hz x 432hz = 2228

Explanation:

the simple explanation is shushh

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

Other Questions
ASAP PLEASE HELP ME!!!!!What is your reaction to what happened in DC on January 6, 2021? Write 4 sentences. 98.92 as a decimal to 2 places Alice wrote an argument against replacing textbooks with tablets in her school. Here is one of her reasons and one piece of evidence to support it:Reason: Many students have insufficient Internet access in their homes. Evidence: About one-third of all Americans do not have broadband Internet at home. Which of the following creates the strongest cohesion between Alices reason and the evidence?A.Many students have insufficient Internet access in their homes. In fact, about one-third of all Americans do not have broadband Internet at home.B.Many students have insufficient Internet access in their homes, but about one-third of all Americans do not have broadband Internet at home.C.Many students have insufficient Internet access in their homes; about one-third of all Americans do not have broadband Internet at home.D.Many students have insufficient Internet access in their homes; for example, about one-third of all Americans do not have broadband Internet at home. Choose the sentence that is grammatical correct written with the verb tener and correct time The U.S. Constitution became, and remains, the __________ law of the land.A.) secondaryB.) onlyC.) supremeD.) tertiary Explain the differences between the roles of consumer, citizen, and worker. Your answer 13 = -2 ( y - 4 ) + 3y Yo __ a las ocho en punto para la fiesta de sopresa de Claudio.A. SaleB. SalgoC. SalenD. Salo 15 divided by 1/9 please i just need 15 divided by 1/9 where do the microtubules of the spindle originate during mitosis in both plant and animal cells ?? a bag contains 3 red sweets and 5 green sweets. Tim takes a sweet at random and eats it. he then takes another sweet. what is the probability that Tim takes 2 red sweets Convert 3 weeks to hours. Use a lable. Does the graph in Exercise 33 have a Hamilton path? Ifso, find such a path. If it does not, give an argument toshow why no such path exist can someone explain because im confused Nativist groups of the late 1800s were best known for? Of the 100 students that were surveyed 36 students saythey were on their phone less than one hour a day. Of the55 females, 40 use their phone more than one hour aday. How many males say they use their phone less thanone hour a day?HELP Discuss how new technology and the use of propaganda changed how governments waged war during World War I. A scientist is treating rice plants with a chemical that causes mutations. What is the possible benefit of this treatment? A. clones B. transgenic plants C. increased genetic variation D. increased hybridization If 5 1/3= x/3 then x= what is the domain of h?