The Ninth Amendment to the U.S. Constitution reads: The enumeration in the Constitution, of certain rights, shall not be construed to deny or disparage others retained by the people. What was the primary reason James Madison argued that it should be included in the Bill of Rights (the first ten amendments to the U.S. Constitution)

Answers

Answer 1

Answer: This amendment include rights of the people which have not been mentioned in the previous Constitutional amendments.

Explanation:

The ninth amendment of the united states constitution describes the rights of the people which were not specifically expressed in the Constitution earlier. Certain rights should not be deny or disparage from people. It reveals those rights which protect people from government infringement and some additional fundamental rights were also added to the constitution after this amendment. Thus these rights should be included in the Bill of Rights.


Related Questions

all contract are agreement but not all agreement are contract discuss​

Answers

A contract cannot be formed without an agreement. An agreement starts from a claim or an offer and ends on consideration though on the other hand, a contract has to be able to achieve another target through the agreement with both parties benefitting on the contract.

The quote sure is correct, is this what you needed by discussing on the topic?

If you attend a peaceful protest, you are exercising which First Amendment right?

freedom of the press

freedom of assembly

freedom of religion

freedom of speech

Answers

Answer: Freedom of speech

Explanation:

Answer:

The answer is all of the above.

Which of the following statements about alcohol consumption is CORRECT?
A)vomiting is a sign the body is getting toxic
B)vomiting at the end of a night of drinking is good
C)coffee will help sober someone up.
D) A person’s BAC will stop after he or she passed out.

Answers

Answer: A

Explanation:

The state of Texas enacts a law that prohibits Asian men from saying the word "God" on any day that is not Sunday. Discuss all of the potential Constitutional law violations that are at play with this law, and how they are at play based on the facts in the prompt.

Answers

Answer:

Never will i answer your quesTimon dolt

Explanation:

HELLO? PLEASE HELP
What purpose of government is shown in the First Amendment?


They help people cooperate


They limit the rights of individuals


They guarantee rights of individuals.


They provide services

Answers

Answer: they guarantee the rights of individuals

Explanation:

They guarantee rights

Which constitutional power can be attributed to the political cartoon

A) implied powers-immigration enforcement

B) concurrent powers-military spending

C) reserved powers- National security

D) enumerated powers-State taxes

Answers

Answer:

A) implied powers-immigration enforcement .

Explanation:

Implied Power of Congress Over Immigration. The Congress shall have Authority. To execute all Regulations which shall be required and matching for leading into Accomplishment the foregoing Laws, and all other Authorities incorporated by this Constitution in the administration of the United States, or any Committee or Administrator thereof.


Officers engaging the public with respectful treatment are
engaging people from all backgrounds.

Answers

Answer:

Officers engaging the public with respectful treatment are engaging people from all backgrounds. Political Parties have always existed in this country going back to the Federalist and Anti-Federalist. ty have held the most sway historically, they too have swung from conservative to liberal planks over time.

Explanation:

3+1
3+2
3+3
3+4
3+5
.............

Answers

Answer:4 ,5,6,7,8

Explanation:

Answer:

Explanation:

4

5

6

7

8

under Chief justice john marshall, surpreme Court descisions generally upheld alexander hamilton's belief that

Answers

Answer:

D. a loose interpretation of the Constitution could be used to increase federal power.

Explanation:

John Marshall was the Chief Justice of the Supreme Court of the United States from 1801 till his death in 1835. Without any prior study in law, he studied law in only just six weeks.

Under Supreme Court's decision under Chief Justice John Marshall upheld Alexander Hamilton's interpretation of the Constitution. Alexander Hamilton advocated broad and liberal interpretation of the Constitution. This belief was upheld by the Supreme Court under Chief Justice John Marshall. The Supreme Court uphelded a loose and liberal interpretation of the Constitution could be used to increase federal power.

Therefore, option D is correct.

True or False: A bill must pass both houses of Congress before the President can
sign it. *

Answers

Answer:

true  cuz I said

Explanation:

yes I believe this is true, with a bit of research I did that’s what it says at least. Hope this helps <3
Other Questions
Answer please I need this quick !!!! Please help! I will give thanks and brainliest if possible! At Breakfast Break, 2 eggs and 1 sausage patty cost $2.23 and 3 eggs with 2 sausage patties cost $3.76. Assuming that these amounts only pay for the eggs and sausage, how much does one sausage patty cost? a pulley is used to lift a 2000 N safe over frosty's head. the safe is lifted 6m in 4s by Rudolph. how much power did Rudolph use? what does hi mean in spanish -8t = 64Answer:t = ?Answer the ? Mark pls How did technology contribute to the expansion of European power through imperialism? Hey guys can one of you help me pls its only one small question The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) slope of 2,11 and 5,2 Hey guys please help!! What is the definition of fourteen points? breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: Steam Workshop Downloader