Answer:
The no. of heterozygous carriers = 0.0392
Explanation:
From the given information:
The incidence of this recessive disorder i.e. q² = 1/2500
q² = 0.0004
q = 0.02
From Hardy Weinberg's Equilibrium.
p + q = 1; &
p² + 2pq + q² = 1
∴
p + 0.02 = 1
p = 1 - 0.02
p = 0.98
So, the numbers of heterozygous carrier 2pq is:
= 2 × 0.98 × 0.02
= 0.0392
What are three differences between rocks and soil
Answer:
Rocks are made of one or more minerals. based on the way the rock was formed: sedimentary metamorphic and igneous Soil is formed of fine rock particles mixed with air, water and particles from dead plant and animal matter.
When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?
if a sample known to be about 11,460 years old and has 400 carbon 14 Adams how many atoms are in the sample when organisms just died
Answer:
There are 1600 atoms when organism just died.
Explanation:
The statement is incorrect. The correct statement is:
If a sample known to be about 11,460 years old and has 400 carbon 14 atoms. How many atoms are in the sample when organisms just died?
The amount of atoms associated with radioactive isotopes decreases exponentially in time by means of the following formula:
[tex]n(t) = n_{o}\cdot e^{-\frac{t}{\tau} }[/tex] (1)
Where:
[tex]n_{o}[/tex] - Initial amount of atoms.
[tex]n(t)[/tex] - Current amount of atoms.
[tex]t[/tex] - Time, measured in years.
[tex]\tau[/tex] - Time constant, measured in years.
In addition, the time constant can be calculated in terms of the half-life of the radioactive isotope ([tex]t_{1/2}[/tex]), measured in years:
[tex]\tau = \frac{t_{1/2}}{\ln 2}[/tex] (2)
If we know that [tex]t_{1/2} = 5,730\,yr[/tex], [tex]t = 11,460\,yr[/tex] and [tex]n(11,460\,yr) = 400[/tex], then the initial amount of atoms is:
[tex]n_{o} = \frac{n(t)}{e^{-\frac{t}{\tau} }}[/tex]
[tex]\tau = \frac{5,730\,yr}{\ln 2}[/tex]
[tex]\tau \approx 8,266.643\,yr[/tex]
[tex]n_{o} = \frac{400}{e^{-\frac{11,460\,yr}{8,266.643\,yr} }}[/tex]
[tex]n_{o} \approx 1600[/tex]
There are 1600 atoms when organism just died.
To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement
Answer:
paper bags jute bags , cotton bags might be used for the environment
True of False: Marsh was able to prove that animals changed over time.
Answer:
True
Explanation:
Hope this helps :D Have a great day..can i hav brainliest?
Which blood component fights and destroys disease-causing bacteria and
viruses?
Answer:
white cells
Explanation:
Which human activity negatively affects the stability of the environment?
Answer:
Some human activities that cause damage (either directly or indirectly) to the environment on a global scale include population growth, overconsumption, overexploitation, pollution, and deforestation, to name but a few.
Explanation:
Brainliest?
Answer 15 and 16 correctly and I will mark as brainliest
Answer:
I think its A and G
Answer:
15. B.
16. H
Explanation:
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
In mature animals when do cells still need to differentiate?
Answer:
As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.
Explanation:
''.''
In mature animals cells differentiate during : Repair and replacement of animal cells
Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.
While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.
Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.
Learn more : https://brainly.com/question/19015367
tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed
Answer:
Naruto usamaki is the greatest hokagey in the leaf village
Wyatt has heart problems
Answer:
If Wyatt has heart problems, Wyatt can eat healthy foods to try and decrease the problems, Wyatt can also make sure that his weight and blood pressure isn't to high. Wyatt can try to get seen at the hospital to make sure everything is fine.
What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?
Answer:
Spiral Galaxies, Elliptical Galaxies & Irregular Galaxies
Explanation:
How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.
The recessive gene for blood typing s...
Type O
Type A
Type B
Type AB
Answer:
Image result for what is The recessive gene for blood typing
Because A is dominant, that means your mother could carry a hidden O. If she does then when she gets pregnant, each child has a 50% chance of getting her dominant A and a 50% chance of getting her hidden, recessive O. If the child gets the O from mom and an O from dad, he or she will have an O blood type.
Explanation:
Brainliest if right?
4 points
The inferred temperature and pressure of Earth's
interior at a depth of 3,000 kilometers are
approximately
(1) 1000°C and 0.5 million atmospheres
(2) 1000°C and 1.0 million atmospheres
(3) 5000°C and 1.5 million atmospheres
(4) 5000°C and 3.0 million atmospheres
Answer:
(4) 5000°C and 3.0 million atmospheres
Explanation:
The inferred temperature is 5000°C and pressure of Earth's interior is 3.0 million atmospheres at a depth of 3,000 kilometers. At the depth of 3000 kilometers, core of the earth is present which is very hot and it is mostly consist of iron. The inner core has a radius of about 1,220 kilometers while the outer core is about 1,400 miles thick which comprise of iron, Nickle, gold, platinum, and uranium elements.
A cell membrane is called _____________ because it allows only certain substances to enter and leave the cell *
a. exocytosis
b. endocytosis
c. semipermeable
d. diffusion
The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.
Answer:
The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.Explanation:
16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits
Answer:
C
Explanation:
The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.
There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.
A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.
Hence, the correct option is C.
please help
Explain how an organ and organelles are related
Answer:
Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.
Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.
What is the relation between organ and organelles?Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.
Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.
Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.
Therefore, organ and organelles differ in their functioning.
Learn more about organ and organelles here:
https://brainly.com/question/22911736
#SPJ2
Through which of the following
would a sound wave travel the fastest?
a. Water vapor in the air
b. Water in the glass
c. Surrounding air
d. The glass
Answer:
D. The glass.
Explanation:
Sound travels fastest through solids. This is because molecules in a solid medium are much closer together than those in a liquid or gas, allowing sound waves to travel more quickly through it.
Hope this helps :D
Write any three differences between mass and weight
please its aurgent fast
Answer:
See explanation
Explanation:
There are a number of differences between mass and weight, they include;
Mass is a scalar quantity whereas weight is a vector quantity.
Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.
The SI unit of mass is kilogram whereas the SI unit of weight is Newton.
A simple life cycle is one in which the offspring look similar to their parents.
True
Or
False
structures in the cell
A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.
multiple choice
Daytime temperatures on Mercury are extremely hot because:
1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes
Answer: it has long days
Explanation:
Why most foods needs to be digested? Give at least 3 reasons
Answer:
Why most foods needs to be digested? Give at least 3 reasons.
Explanation:
Foods must be digested cause of the following reasons:
1. To get energy the food must be digested.
2. To provide nourishing vitamins and minerals to our body.
3. You will be affected by some diseases if you didn't digest your food.
Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem
give two examples of asexual Productions
Answer:
Asexual Reproduction Examples
Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v
Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?
Answer:
Abnormally high temperature
Explanation:
Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.
When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.
What is a constant?
O a variable
a number that stands alone with no variable
O the number in front of the variable
O two terms that look exactly the same
need help please
Answer:
a number that stands alone with no variable
Hope this helps!
it takes 25 min to cook 10 egg how long does it take to cook 20
Answer:
it takes 50 min
Explanation:
20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.
Work for it:
10 x 2 = 20
10 eggs=10 min
25x2=50
Answer:
it takes 50 minutes to cook 20 eggs
Explanation:
ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50
hope this helps