The atmosphere of Earth is made up of nitrogen, oxygen, water vapor, carbon dioxide, methane, nitrous
oxide, and ozone. Of these, 99% of the atmosphere is composed of:

Answers

Answer 1

Answer:

Nitrogen and oxygen account for 99 percent of the gases in dry air,


Related Questions

hello please help i’ll give brainliest

Answers

Answer: Clastic sedimentary rocks are made up of pieces (clasts) of pre-existing rocks. Pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. If the sediment is buried deeply, it becomes compacted and cemented, forming sedimentary rock.

Explanation:

Atoms are the most basic unit of matter. Two or more atoms from the same or different elements can combine to form molecules.
Cells are the most basic unit of life. Cells are made up of many different types of molecules. Which of the following accurately shows higher levels of organization within organisms, from least complex to most complex?
A. cells → organs → organ systems → tissues → organism
B. cells → tissues → organs → organ systems → organism
C. cells → organ systems → organs → tissues → organism
D. cells → organs → tissues → organ systems → organism

Answers

Answer:

B

Explanation:

Because cells make tissues which then combine to make organs which then further combine to form system

Which makes organisms like me and you

Answer: B

(An atom is the smallest unit of matter that retains all of the chemical properties of an element. Atoms combine to form molecules, which then interact to form solids, gases, or liquids. For example, water is composed of hydrogen and oxygen atoms that have combined to form water molecules.)

Explanation : Because cells make tissues which then combine to make organs which then further combine to form system

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

son las fallas evidencias de la tectónica de placas de nuestro planeta Y por qué​

Answers

Answer:

you're speaking in the wrong language here

Explanation:

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

Need help ASAP! Will give brainliest;) NO links please, will report.

Which statement is part of Darwin’s theory of evolution by natural selection?

A). Acquired characteristics that are inherited are the cause of evolution.

B). The organisms that are the fittest are always largest and strongest.

C). The number of offspring is not related to fitness.

D). More offspring are produced than can possibly survive.

Answers

D

More offspring are produced than can possibly survive.

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

What is likely to happen when there is more genetic diversity?

A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving

Answers

Answer:

b

Explanation:

if there is more genetic diversity then the organism will adapt much better to the environment around it

Answer:

B

Explanation:

ggggggggggggggggggggggg

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

blue, light blue, yellow, or red

HURRY

Answers

Answer:blue

Explanation:

the answer to the question is the color blue

When spindle fibers do not correctly separate the chromosomes during anaphase we get a condition called _________?
A. Duplication
B. Nondisjunction
C. Translocation

Answers

The answer is no disjunction

Explanation:

..........................................

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

Why is the reduction in chromosomes number important in meiosis?

Answers

Explanation:

Because meiosis creates cells that are destined to become gametes (or reproductive cells), this reduction in chromosome number is critical — without it, the union of two gametes during fertilization would result in offspring with twice the normal number of chromosomes.

Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos

Answers

From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

What are coral reefs?

Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.

The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.

The balance in coral reefs can be disrupted by human activities such as:

Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photos

However, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

Learn more about coral reefs at: https://brainly.com/question/10970167

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

Cuales son las características anatómicas de las fosas nasales

Answers

El interior de las fosas nasales está tapizado por una membrana mucosa, que se divide en mucosa respiratoria y mucosa olfativa. La mucosa respiratoria (antiguamente pituitaria roja) recubre la mayor parte de la fosa nasal y contiene células ciliadas y células caliciformes que secretan moco.

A key part of the Watson-Crick model came when Watson realized
that adenine could form hydrogen bonds with thymine and guanine
could form hydrogen bonds with cytosine. This explains why A=T
and G C in Chargaff's rules. Also, these two hydrogen-bonded
nucleotide pairs had the exact same width, so they could form the
rungs of the DNA ladder.
The fact that these pairs could match up only in this way meant that
the sequence of bases in one strand could determine the sequence
of bases in a second strand created from the first. The second strand
is said to be complementary to the first strand. Individual bases are
paired so that the identity of any base determines the identity of the
base paired with it; that is, the complementary base.
This table lists the base abbreviations for bases in a sample of single-
stranded DNA. Fill in the second column with the base abbreviations
that are complementary to the given bases.
I

Answers

Answer:

A–T

T–A

T–A

C–G

A–T

G–C

G–C

C–G

T–A

A–T

Explanation:

A always pairs up with T

C always pairs up with G

A - TT - AT - AC - GA - TG - CG-CC - GT - AA - T

A usually pairs up with TC usually pairs up with GThese are bases of amino acids called nucleotides sequences. And this helps in the bond of several base pairs to their nucleotide sequence.What is the Watson-Crick model?

In “A Structure of Deoxyribose Nucleic Acid,” Watson and Crick defined DNA as a double helix that contained long, helical strands wound together. In their model, every DNA strand contained personal devices referred to as bases, and the bases alongside one DNA strand matched the bases alongside the opposite DNA strand.

Thus it is clear that the above answer is well explained.

To know more about the DNA  refer to the link :

https://brainly.com/question/1328358

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

how does an increase in volume affect the gas pressure in a balloon

Answers

Answer:

Boyle's Law explains the relationship between volume and pressure. According to Boyle's Law, the volume of a fixed amount of gas decreases as its pressure increases. If the volume increases, its pressure decreases.

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

what does arrows mean in science

Answers

It means that something lead to something else.like an chain reaction or in food chain wise this animal gains energy from this animal or plant

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

20. What is true about the esophagus? Check all that apply.* ]

Answers

Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one

Explanation:

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

Other Questions
Read the sonnet.Sonnet XIIby William ShakespeareWhen I do count the clock that tells the time,And see the brave day sunk in hideous night;When I behold the violet past prime,And sable curls all silvered o'er with white;When lofty trees I see barren of leaves Which erst from heat did canopy the herd,And summer's green all girded up in sheavesBorne on the bier with white and bristly beard,Then of thy beauty do I question make,That thou among the wastes of time must go, Since sweets and beauties do themselves forsakeAnd die as fast as they see others grow; And nothing 'gainst Time's scythe can make defence Save breed, to brave him when he takes thee hence.Read the first quatrain of "Sonnet XII."How does the rhyming of time with prime affect the poem? It encourages the reader to read the poem aloud. It emphasizes the quatrain's theme of the passage of time. It shows how time and prime share the same meaning. It makes the language easier to understand. In summer, the price of strawberries goes up by $1.25 per pound. Sam bought two pounds of strawberries at the new price for $8.46. Write an algebraic equation to determine the original price per pound (s). Use the equation to find the original price per pound.Show your work. I NEED HELP ASAPOnly do 3-5 Who am i? What am i? What is the median of the following data set? 6.1, 4.5, 4.2, 5.0, 6.5, 5.9, 5.7 REWARDING BRAINLY Why does the narrator describe Hannah's comment as passive- aggressive in paragraph 7? The female gametes are called__________. *spermova What is the probability of rolling a 6 and then a 7 on a number cube?NO LINKS PLEASE! Place the following events in sequence: A)William Pitt rises to power in Great Britain: B) France destroys British forts in upstate New York; C) The British capture Montreal I WILL GIVE BRAINLY IF CORRECTWhat can patient vital signs and symptoms tell us about what is happening in the human body? Make sure to list and describe the four major vital signs medical professionals use and how they are measure. 1. PresidentWhat are the requirementsto run for the followingoffices? (Minimum age, ,years of citizenship, naturalborn citizen, etc...)2. House of Representatives3. Senate Organisms of either extreme characteristic dying out while organisms with the medium characteristic have a higher fitness is identified as? Solve for x in the diagram below. A. 65B. 30C. 10D. 50 The enharmonic of Db is . B. D# C. C# D. C Which is a benefit of a scientific model?A.) It provides a complete image of the concept it is modeling.B.) It provides an accurate scale of the concept it is modeling.C.) It provides an accurate visual representation of the texture and coloring of the concept it is modeling.D.) It provides a useful understanding of the concept it is modeling. Can you help me with Math PLEASE HELP!!!!!!!!!!! New England was considered the center of industrial progress. Which of the following best describes a geographical advantage of New England? A. CapitalB. Avaliabillity of unskilled workers. C. Resource Proximity PLEASEEEE HELPPP MEEE.DUE RIGHT NOW!!Topic: MathSolve all the questions