Select all equations that have graphs with the same y-intercept.

y = 3x - 8
y = 3x - 9
y = 3x + 8
y = 5x - 8
y = 2x - 8
y = (1/3)x - 8

Answers

Answer 1
y=3x-8
y=5x-8
y=2x-8
y=1/3x-8
the y intercept is the b in y=mx+b and all of these have -8 as the y int
Answer 2

The equations that have graphs with the same y-intercept are:

y = 3x - 8y = 5x - 8y = 2x - 8y = (1/3)x - 8

To determine which equations have graphs with the same y-intercept, we need to look for equations that have the same constant term when written in the form y = mx + b, where m represents the slope and b represents the y-intercept.

The y-intercept is the value of y when x is equal to 0. In other words, it is the point where the graph intersects the y-axis.

Let's compare the equations and their constant terms:

y = 3x - 8 (Constant term: -8)

y = 3x - 9 (Constant term: -9)

y = 3x + 8 (Constant term: 8)

y = 5x - 8 (Constant term: -8)

y = 2x - 8 (Constant term: -8)

y = (1/3)x - 8 (Constant term: -8)

From the comparison, we can see that the equations y = 3x - 8, y = 5x - 8, y = 2x - 8, and y = (1/3)x - 8 all have the same constant term of -8. This means that their graphs will have the same y-intercept, which is -8.

Therefore, the equations that have graphs with the same y-intercept are:

y = 3x - 8

y = 5x - 8

y = 2x - 8

y = (1/3)x - 8

Learn more about intercept here:

https://brainly.com/question/14180189

#SPJ2


Related Questions

HELPP I'LL GIVE YOU BRAINIEST!! PLEASE SHOW WORK TOO!! ( ONLY PROBLEMS 1-8 )
25 PTS!!

Answers

Answer:

look in explanation

Step-by-step explanation:

1) bisector means cutting an angle in half. the small lines between segment SM and MT mean they are congruent. this means MW is a bisector. Since both halves of ST are congruent, we know SM = 19. 19+19=38

2) same logic here, M bisects ST. set both halves of ST equal to each other and solve.

3x-6=x+8

2x+14

x=7

plug back in to find MT (7)+8=15. MT=SM so double 15 to get ST. ST=30

3) the bisector will be exactly halfway between the points.

4) find difference between x and y values, and divide by 2

2-2=0 0/2=0 x moves 0

13-1=12 12/2=6 y moves 6

so add 0 and 6 to 2,1 to get (2,7)

5) same process

6--6=12 12/2=6

6-0=6 6/2=3

add 6 and 3 to -6,0 to get (0,3)

6) find the change in x and y between the coordinate sets. (x: 1- -1=2) (y: 2-4=-2) take the opposite of those values and add them to M

(x:1-2=-1) (y:2+2=4)

(-1, 4) are the other coordinates for C

7) take the same steps

(x:3-1=2) (y:7-1=6)

use -2 and -6

(x:3-2=1) (y:7-6=1)

(1,1) are other coordinates for C

8) use distance formula

sqrt (x1-x2)^2 + (y1-y2)^2

sqrt(1--1)^2 +(2-4)^2

sqrt (2)^2 +(-2)^2

sqrt 4+4

sqrt 8

9) same process

sqrt (-1-3)^2+(-5--8)^2

sqrt (-4)^2 +(3)^2

sqrt 16+9

sqrt 25

5

Solve the perimeter formula for an isosceles triangle, P = 2a + b for a.


a = P + 2b



a = P – 2b

Answers

Step-by-step explanation:

subtract b to get P-b=2a. divide each side by 2 to get (P-b)/2=a

f(x) is a function true or false?​

Answers

Answer:

yes True

Step-by-step explanation:

thank you so much

8x - 4
6x + 8
Find the measure of angle 1.

Answers

Answer:

44°

Step-by-step explanation:

8x-4 = 6x+8

8x - 6x = 8 + 4

2x = 12

x = 12/2

x = 6

then:

8*6 - 4 = 48 - 4 = 44°

The measure of angle 1:

44°

Lisa started with $50 and saved $15 a week. Which equation describes the growth of her savings with X as the number of weeks and Y as the total dollars?

Answers

Answer:

I believe its X=15Y+50

Step-by-step explanation:

Solve:
(-5) + (-18) =
A-13
B
--23
C С
23
D
13

Answers

B -23 because adding two negatives keeps the negative on. So add the numbers like positives and then re-add the negative back on

it is -23 I think

Step-by-step explanation:

(-5)+(-18)=-23

a sports store sells three different packs of tennis balls. which pack is the best to buy? 4 sleeves for 11.49, 6 sleeves for 16.79, 9 sleeves for 22.99​

Answers

Answer:

9 sleeves for 22.99

Step-by-step explanation

The first pack has a unit rate of $11.49/ 4 balls

=$2.8725

The second pack has a unit rate of $16.79/6balls

=$2.798 per ball

the third pack has a unit rate of $22.99/9balls

=2.554

So, I would definitely go for the third pack since it has the least cost.

Please help me !

Juan drew line segment EF on the coordinate plane. Determine the distance between the points E and F. Round your number to the nearest hundredth

Answers

Step-by-step explanation:

sogzglzotsoypysotaota9t8ts

It would be 120 ye  f  = 8  E = 3 1/2  

Which lengths can be used, directly or indirectly, to calculate the volume of the hexagonal right pyramid? Select three options. XY and ST VU and TW XS and XW TX and WX VU and YZ

Answers

Answer:

XYand ST , VU and TW, TX and WX

Step-by-step explanation:

Volume of hexagonal right pyramid =[tex]\frac{1}{3}[/tex]×Area of base ×height

Area of base =[tex]\frac{1}{2}[/tex]×apothem ×perimeter

if we consider face TXY  ,here height =ST  and  length XY

(b) consider face TVW,  length VU and TW

(d) consider face TWX, length WX and TX  

Hence lengths in options (a),(b),(d) can be used to find the volume of hexagonal right pyramid .

Answer:

A, B, D

Step-by-step explanation:

EDGE 22

Lisa is buying a computer for $1,500. The sales tax rate is 8.5%. Which expression should be used to calculate t, the total cost for the computer including tax?

Answers

Answer:

t=$1627.5

Step-by-step explanation:

Step one:

given data

price of computer= $1500

sales tax= 8.5%

Step two

Let us compute the amount in tax

tax= 8.5/100*1500

=0.085*1500

=$127.5

Let the total cost be t

hence

t=1500+0.085*1500

t=1500+127.5

t=$1627.5

An item is regularly priced at $15. Kala bought it on sale for 75% off the regular price find out how much Kalla paid ​

Answers

Answer:

$11.25

Step-by-step explanation:

you take 75% of 15

Answer:

11.25

Step-by-step explanation:

because I used a calculator

Evaluate each algebraic expression for x = -2,3, -0.5, and 1 1/2
2). 4X. 3) 3x+2

PLEASE HELP URGET!!

Answers

Answer:

Step-by-step explanation:

2. 4x= 4*(-2)=-8

4x=4*(3)=12

4x=4*(-0.5)=-2

4x=4*3/2=6

the 3x+2

3x+2=3*(-2)+2=-6+2=-4

3x+2=3*(3)+2=11

3x+2=3*(-0.5)+2=-1.5+2=0.5

3x+2=3*(3/2)+2=9/2+2=13/2=6 1/2

Simplify each algebraic expression.
2a +3(a +7)–(3a +3)

Answers

Answer:

2a+18

Step-by-step explanation:

[tex]2a +3(a +7)-(3a +3)\\\\Expand\: 3(a +7) :\\3a+21\\\\=2a+3a+21-\left(3a+3\right)\\\\-(3a+3)=-3a-3\\\\=2a+3a+21-3a-3\\\\Simplify\\\\=2a+18[/tex]

Find The Quotient of 5/6÷ (-13/7)
5/6÷(-13/7)=5/6. ​

Answers

Answer:

- 35/78

Step-by-step explanation:

The quotient of

5/6÷ (-13/7) =5/6×(-7/13) =- 35/78

The school is landscaping an area for a soccer field. If the
dimensions are 60 feet by 35 feet. What is the area of the soccer
field?

Answers

Answer: 2100 square feet

Step-by-step explanation: 60 x 35=2100

Answer:

2100 ft squared!

Step-by-step explanation:

The formula to find the area of a rectangle is L * W = A

Where A is the total area, and L and W are the dimensions.

Since we know what the dimensions of the rectangles are, we can replace L and W to find out the area. This will look like this: 60 * 35 = A

Now we just have to multiply 60 and 35 to find A. This will simplify to 2100, which means the total are of the rectangle, or in this case, the soccer field, is 2100 ft squared!

Ryan was paid $75 for
working 6­ 1/4 hours.

How much money
did he make per hour?

A. $12.50

B. $12

C. $15

Answers

Answer:

the answer is b

Step-by-step explanation:

12:

Step-by-step explanation:

answers for the 2 boxes please ​

Answers

i believe it’s (4,22)
i’m sorry if that’s not correct
have a great day!:)

Answer:

(4, 22)

Step-by-step explanation:

y = 5x + 2

y  = 3x + 10

Since both equations are equal to y, we can have both equations equal to each other).

5x + 2 = 3x + 10

5x + 2 - 3x - 2 = 3x + 10 - 3x - 2

5x - 3x = 10 - 2

2x = 8

2x/2 = 8/2

x = 4

(Substitute the x value to any equation to solve for y).

y = 5x + 2

y = 5(4) + 2

y = 20 + 2

y = 22

So, the answer is (4, 22).

Hope this helped! <3

1. 3/5 divided by 6.
2. 10/8 divided by 5
3. 6 divided by 3/8.

Answers

1. 1\10

2. 1/4

3.16

Step-by-step explanation:

your welcome

word form 952.374 pls help

Answers

Answer:

WORD from the 2.O

Step-by-step explanation:

for every 6 white roses, there are 8 pink roses. If the floral arrangement is proportional then how many pink roses are in a arrangement with 10 white roses

Answers

Answer:

13.33 pink roses

Step-by-step explanation:

We are told the floral arrangements are proportional , hence:

6 white roses = 8 pink roses

10 white roses = x

Cross Multiply

6 white roses × x = 10 white rose × 8 pink roses

x = 10 white roses × 8 pink roses/6 white roses

x = 13.333333333 pink roses

x ≈ 13.33 pink roses

van purchased a DVD player on sale the original price was $171.50 the sale price was $149.37 what is the first step finding the percent markdown find the percent markdown

Answers

Answer:

12.90%

Step-by-step explanation:

Given ;

Original price = 171.50

Sale price = 149.37

To find the % markdown :

Markdown = Purchase price - sale price

171.50 - 149.37 = 22.13

(Markdown / purchase price) * 100%

(22.13 / 171.50) * 100%

0.1290379 * 100%

= 12.90%

Here are the marks of a student in four exams. 65 80 76 69 The student takes a fifth exam. His mean mark for the five exams is 70 Work out his mark in the fifth exam

Answers

Answer:

mark of the fifth exam = 60

Step-by-step explanation:

Mean = sum of all marks / number of exam

Mean = 70

Number of exam = 5

Let x =

Mean = sum of all marks / number of exam

70 = (65 + 80 + 76 + 69 + x) / 5

Cross product

70 × 5 = (290 + x)

350 = 290 + x

350 - 290 = x

x = 60

mark of the fifth exam = 60

Some people advise that in very cold​ weather, you should keep the gas tank in your car more than half full. Irene ​'s car had 5.9 gallons in the14 ​-gallon tank on the coldest day of the year. Irene filled the tank with gas that cost ​$3.60 per gallon. How much did Irene spend on​ gas

Answers

Answer:

I believe it is $21.24 im sure

The cost of a t-shirt was $30. Now the t-shirt costs $37.50. What is the percent of change? Do the work on your own paper and write your answer as a number.

Answers

Answer:

25%

Step-by-step explanation:

Given that,

Initial cost of a t-shirt = $30

Final cost of a t-shirt = $37.50

We need to find percent of change. The percentage change in any value is given by :

[tex]\%=\dfrac{\text{final value-initial value}}{\text{initial value}}\times 100\\\\=\dfrac{37.5-30}{30}\times 100\\\\=25\%[/tex]

Hence, the percentage error is 25%.

Item 4
Question 1
Solve −2s<−10. Graph the solution.

Answers

Answer= s > 10/2

s > -10/-2

s > 10/2

solve this inequality for x: -46 -8x >22.

Answers

Answer:

Step-by-step explanation:

The key to answering this is to know that the only time you'll change the direction of the sign is when you multiply or divide by a negative number.

-46 - 8x > 22

-8x > 22 + 46

-8x > 68

x < 68/-8        (we divided by -8 so the inequality changed direction)

x < -17/2

Step-by-step explanation:

-46 - 8x > 22: Original problem

-46 - 8x + 46 > 22 + 46: Bringing all the constants to one side of the inequality

-8x > 68: Simplification

x < 68/-8 : You have to flip the inequality symbol because you are dividing by                                

                  a negative number..

x< -8.5 : The answer!!!!!

Checking your answer....

-46 - 8x > 22 : Original problem

-46 - 8(-8.5) > 22 : Substitution

-46 + 68 > 22 : Simplification

22 > 22 : Answer check successful!!!

(22 is not greater than 22 but we know that the answer cannot be -8.5 because the inequality states that x is less -8.5. This process was only for the purpose of checking not for the purpose of proving)

Hope this helps!!!!

Write the equation that represents the situation then determine the cost of 5 cans of coffee: A supermarket sells 2 cans of ground coffee for$18.50. The cost of coffee varies directly with the number of cans.

Answers

Answer:

The equation is;

C = kg

c is the cost in $

k is the proportionality constant $/can

g is the number of cans

cost of 5 cans of coffee is $46.25

Step-by-step explanation:

From the question, 2 cans of ground coffee costs $18.50

Let c be the cost and g be the number of ground coffee

18.50 = k * 2

where k is the constant of proportionality;

k = 18.5/2

k = 9.25

So, the cost of 5 coffee cans will be;

c = 9.25 * 5 = $46.25

3s+2p=85.50 4s+2p=123

Answers

Answer:s=10.50 and p=27

Step-by-step explanation:

Select the correct answer.
Which expression is equivalent to 13 square root 22b - 10 square root 22b, if b>0?

A. 23 square root 22b
B. 130 square root 22b
C. 3 square root b^2
D. 3 square root 22b

Answers

Given:

The expression is

[tex]13\sqrt {22b}-10\sqrt{22b}, b>0[/tex]

To find:

The equivalent expression.

Solution:

We have,

[tex]13\sqrt {22b}-10\sqrt{22b}[/tex]

Taking out common factors.

[tex]=(13-10)\sqrt {22b}[/tex]

[tex]=(3)\sqrt {22b}[/tex]

[tex]=3\sqrt {22b}[/tex]

The expression [tex]3\sqrt {22b}[/tex] is equivalent to the given expression.

Therefore, the correct option is D.

what is the geometric mean of 0.5 and 2

Answers

Answer:

5

Step-by-step explanation:

Other Questions
6 is 16% of what number? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick Write the inverse of each function. a. f(x)=x103b. g(x)=3/4x+6Please help me I beg you!!!! 25 points!!!! I need to pass!!! A 12,000-gallon pool is being filled at a rate of 40 gallons per minute. At this rate, how many minutes will it take to fill the pool 3/4 full? Abdul bought a loaf of bread for $1.59 and a package of cheese for $2.69. How much did Abdul spend? Explain the role that Benjamin Franklin played during the American Revolution.. After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. When Muhammad was a boy, he received religious teaching from whom?Group of answer choicesJewsPolytheistsProtestant ChristiansNestorian Christians condemned to be heretics Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines pls help asap!! no trolls 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. i cant ever forgive the vampire diaries producers and directors for killing enzo but letting ratty matty the human LIVE?? like why did they keep matt alive when no one liked him but KILLED ENZOOOOOO How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Steam Workshop Downloader