Please help me with this question please!!!
Look at the picture provided and answer the question

>>Select one only.
Q:An aromatic hydrocarbon is represented by which structural formula?
>>Choose one answer from the picture below that answers the question above
A
B
C
D

Please Help Me With This Question Please!!!Look At The Picture Provided And Answer The Question >>Select

Answers

Answer 1

Answer:

A

Explanation:

I looked up aromatic hydrocarbon and this one looks like a replica of benzene


Related Questions

What happens when liquid changes to gas?


1.Added heat makes water molecules move fast enough to overcome the attraction
between them
2. Heat causes molecules to speed up and merge together (Which one?)

Answers

Answer:

#1

The temperature that this happens is called the freezing point and is the same temperature as the melting point. As more energy is put into the system, the water heats up, the molecules begin moving faster and faster until there is finally enough energy in the system to totally overcome the attractive forces.

Explanation:

#2

Heating a liquid increases the speed of the molecules. An increase in the speed of the molecules competes with the attraction between molecules and causes molecules to move a little further apart. ... A decrease in the speed of the molecules allows the attractions between molecules to bring them a little closer together.

what is potential energy?

Answers

Answer:

energy held by by an object becuase of its position relative to other objects

Explanation:

Answer:

The energy possessed by a body by virtue of its position relative to others, stresses within itself, electric charge , other factors.

Explanation:

I looked it up because i wanted to be sweet and help ((:

Of the three types of plate boundaries, which type is most likely to be associated
with pulling or tension forces?
transform
convergent
divergent

Answers

transformative forces

What is the definition of hydro energy

Answers

Answer:

a form of energy that harnesses the power of water in motion—such as water flowing over a waterfall—to generate electricity.

Explanation

After two alpha decays, Carbon-14 will become?

Answers

Answer:

Becomes Nitrogen-14

Explanation:

The only way to see the far side of the moon is

Answers

The side of the Moon we do not see from Earth gets just as much sunlight on it as the side we do see. In truth, the only dark side of the Moon is the side that is pointed away from the Sun at any given time.The moon's mysterious far side is so much different than its near side, which we see in the night sky, and now scientists think they know why. ... In fact, observations have shown that only about 1% of the moon's far side is covered with maria, or craters caused by volcanic activity on the moon.

Answer:

Only one side of the spherical Moon is ever visible from Earth it wasn't until 1959 when the Soviet Spacecraft Luna 3 orbited the Moon and sent pictures home that human beings were able to see the "far side" of the Moon for the first time. A phenomenon called tidal locking is responsible for the consistent view

Order the following atoms from smallest to largest atomic radius: C, N, P

Answers

Answer:

N ∠ C ∠ P

Explanation:

Atomic radius:

It is define as the distance from nucleus of an atom the outer most electronic shell.

As we move down the group atomic radii increased because of increase of atomic number.  Electrons are added in next level cause the atomic radii to increased. The hold of nucleus on valance shell become weaker because of shielding of electrons thus size of atom increased.

When we move from left to right across the periodic table electron are added in the same shell at the same time protons are also added in the nucleus hence positive charge is going to increase and this effect lead to the greater nuclear attraction. The electrons are pull towards the nucleus and valance shell get closer to the nucleus and atomic radii decreases.

Carbon and nitrogen are present in period 2 while phosphorus is present in period 3 thus phosphorus has largest atomic radii. Carbon and nitrogen are present in same period but nitrogen is more right as compared to the carbon which means nitrogen has one more valence electron thus its size is smaller than carbon.

Values of atomic radii.

P = 98pm

C = 67pm

N = 65 pm

N ∠ C ∠ P

Attempt 1
Question
You see Fred, a co-worker, not following safety procedures. What would be the best
thing to do?
A) nothing, as his safety is his own responsibility
B) pretend you didn't see him, but consider telling the boss
C) talk to him about putting his safety at risk
D) follow his example -- maybe the safety procedures are not necessary

Answers

Answer:

Would be C

Explanation:

helpig and bringing noice to a persons safety is always the right thing. C is correct, hope this helps

14. A researcher Is curious to find out what effect classical music has on people's level of relaxation
(as measured by heart rate). She suspects that listening to classical music will make people feel
more calm and relaxed. The researcher lets one group listen to classical music for one hour and
then do a relaxing activity, like reading or drawing for another hour. She lets the other group sit in a
qulet room for two hours (they hear no music). After two hours, she monitors the heart rate of each
participant to measure their level of relaxation.
What is the error in thls experiment design?
A. There are two independent variables: classical music and an additional relaxing activity
B. There are two independent variables: the amount of time and heart rates
C. There are two dependent variables: classical music and an additional relaxing activity
D. There are two dependent variables: the amount of time and heart rates

Answers

Answer:

It should be "B"

Explanation:

:) :) :) :) :) :)

what are all the populations of different species that live in the same area at the same time

Answers

Answer:

The answer is Community  

Explanation:

Molecules have Question 10 options: A) both potential and kinetic energy. B) neither kinetic nor potential energy. C) only potential energy. D) only kinetic energy.

Answers

I think the answer is D.

Answer:

B?

Explanation:

A ball, starting from rest at Position 1, rolls down and then up a curved track towards Position 5. When it reaches Position 5, it rolls back down the track
2
Which description below is most consistent with what you can expect from the ball's motion?
The ball will roll as high as Position 1 since energy cannot be created or destroyed.
The ball will roll past Position 1 since energy cannot be created or destroyed.
The ball will roll as high as Position 2 since some of the energy will be transformed to heat,
The ball will roll as high as Position 3 since that position has the least potential energy.
Kk

Answers

Answer:

D. The ball will roll as high as Position 3 since that position has the least potential energy.

Explanation:

i am not sure that it's is right or wrong

If you find a chemical in the lab and are unsure of
its identity, what is the best way to find out what it
is?

Answers

Answer:

C. read the label on the container

Explanation:

What information is found in an SDS? Check all that apply.

A. the identification of the chemical

C. the chemical and physical properties of the substance

D. the first-aid measures to take if an accident occurs involving the chemical

Answer:

C

Explanation:

just did it

PWEaseee help mweee ill mark brainliest I just need the answer pls and thank you amazing people

Answers

The answers is that minerals are not organic.

Type the correct answer in the box, Express the answer to three significant figures. Given: N2 + 3Cl2 + 2NC3, AH = 464 kJ/mol Use the given bond energies and the periodic table to calculate the energy change in the reaction. The AH when 85.3 grams of chlorine reacts in the given reaction is kilojoules.​

Answers

Answer:

The given chemical reaction is:

Δ∑BE(reactants)-∑BE(products)

                = {(941 kJ/mol) + (3 * 242 kJ/mol)} -[{2*(3*200 kJ/mol)}]

                    = 467 kJ/mol

Calculating the change in heat when 85.3 g chlorine reacts in the above reaction:

Moles of chlorine =  

                            = 1.20 mol  

Heat change when 1.20 mol chlorine reacts

                            =

Explanation:

Answer:

He is right tho not gone hold you

Explanation:

Question 1
Identify the type of bonding for CaBr2

Answers

CaBr2 is an ionic bond. This is because the calcium gives up an electron to each of the chlorine atoms resulting in the calcium becoming Ca2+ ions...

Balancing Equations
Fe + O2 --> Fe2O3

Answers

Answer:

4Fe + 3O2 --> 2Fe2O3

Explanation:

A bicycle tire has a pressure of 18.5 lb/in^2 What's the pressure in torr?

Answers

Answer:

B y is a complete collection for your time and energy for the spread of Islam in the Horn of the following to make sure

You use a battery to power a small hand-held fan to keep cool in the summer what way is the energy transformed?

Answers

Answer:

Chemical to electrical to kinetic energy

Explanation:

In a battery-operated fan, first, the chemical energy stored in the battery is converted to electrical energy within the fan and then the electrical energy, in turn, is converted to kinetic energy which makes the blades of the fan rotate. The rotation of the fan creates a breeze that forces the evaporation of sweat molecules from the surface of the skin and causes cooling in return.

I need help really bad with this!!!

For the following:
Highlight each subscript in RED.
Highlight each coefficient in BLUE.

H2O 5Cl2 2Mg 3H2O2

For the following
List the chemical symbols of each element.
Give the number of atoms of each element.

HCl CO2 Na2SO4



Balance the following chemical equations.

1. Cu2O + C → Cu + CO2



2. H2O2 → H2O + O2



Al + Fe3N2 → AlN + Fe

4. Ag2S → Ag + S8



5. ZnS + AlP → Zn3P2 + Al2S3



6. Fe(OH)3 → Fe2O3 + H2O



Given the two chemical equations, highlight in RED the one that is balanced.

7. a. 2Na + Cl2 → 2NaCl

b. 2Na + 2Cl2 → 2NaCl


8. a. C3H8 + 5O2 → 3CO2 + 4H2O b. 2C3H8 + 5O2 → 3CO2 + 8H2O

9. a. 2NH3 + 5O2 → 2NO + 3H2O b. 4NH3 + 5O2 → 4NO + 6H2O

10. a. Y(NO3)2 + GaPO4 → YPO4 + Ga(NO3)2

b. 2Y(NO3)2 + 2GaPO4 → 2YPO4 + Ga(NO3)2

Answers

Answer:

Did u get the answers

Explanation:

If 24 moles oxygen gas combined with 24 moles hydrogen gas, what would be the limiting reactant?

Answers

Hydrogen, since in H2O there are two hydrogen atoms per one oxygen atom. So the hydrogen atoms would run out first so that there are 12 H2O molecules, where all the hydrogen is used and there are 12 oxygen atoms left over

Which of the following correctly lists the levels of organization from most complex to least complex? *

Community, Organism, Population, Ecosystem
Ecosystem, Community, Population, Organism
Population, Community, Ecosystem, Organism
Organism, Population, Community, Ecosystem

Answers

Answer:

The last option.

Explanation:

You can immediately eliminate the other options as an organism is clearly the least complex. Only one option begins w/ 'organism'.

Answer:

Its def A, if this helped subscribe to amiredagoat Yt

Explanation:

which element has two valence electrons in the s sublevel of the fourth energy level ​

Answers

The element is americium, a metal from the actinides. The element is in Period 4 and Group 2. Even though the 4s sublevel is filled, the last electron went into that sublevel, making it a member of the s-block. It has 2 valence electrons.

Which elements have two valence electrons?
A. Carbon
B. Magnesium
C. Fluorine
D. Sodium​

Answers

Answer:

Magnesium

Explanation:

Magnesium is in group 2 of the periodic table. The group in which an element is found in tells us the number of valence eletrons it has.

HOPE THIS HELPED

Among the given elements, the element that have two valence electrons is Magnesium. The correct answer is option B.

Valence electrons are the electrons that are present in the outermost shell of an atom that are involved in chemical bonding. The number of valence electrons an atom has is determined by the group number it belongs to on the periodic table.

Magnesium belongs to group 2A on the periodic table, which means it has two valence electrons.

Carbon belongs to group 4A and has four valence electrons, while Fluorine belongs to group 7A and has seven valence electrons. And Sodium belongs to group 1A and has one valence electron.

Therefore, option B. Magnesium is the elements that have two valence electrons.

Learn more about Valence here:

https://brainly.com/question/31264554

#SPJ6


What is chemical potential energy?
A. Energy stored by atoms
B. Energy of motion
C. Energy stored in height differences
D. Energy from gravity

Answers

The correct answer is d

Answer:

the answer is A.

i think:/

Explanation:

Which of the following is a layer of the solid Earth?

Answers

Answer:

The inner core is solid. But the mantle is solid/plastic

Explanation:

I completed the class Earth science

Answer:

The answer on study island in the LITHOSPHERE.

Explanation:

What common kitchen appliance uses radiation to heat food ?

Answers

Answer:

microwave

Explanation:

Answer:

Toaster ovens & Microwave

Explanation:

How many moles of nitrogen are in a 14.57 gram sample of nitrogen?

Answers

Answer:

[tex]\boxed {\boxed {\sf About \ 1.040 \ moles \ of \ nitrogen }}[/tex]

Explanation:

To convert from grams to moles, we must use the molar mass. This can be found on the Periodic Table. We have a sample of nitrogen, so look for N on the table.

Nitrogen (N): 14.007 g/mol

Now, use this molar mass as a ratio.

[tex]\frac {14.007 \ g \ N }{1 \ mol \ N }[/tex]

Multiply by the number of grams in the sample (14.57)

[tex]14.57 \ g \ N *\frac {14.007 \ g \ N }{1 \ mol \ N }[/tex]

Flip the fraction so the grams of nitrogen will cancel.

[tex]14.57 \ g \ N *\frac {1 \ mol \ N }{14.007 \ g \ N}[/tex]

[tex]14.57 *\frac {1 \ mol \ N }{14.007 }[/tex]

[tex]\frac {14.57 \ mol \ N }{14.007 }[/tex]

[tex]1.04019419 \ mol \ N \\[/tex]

The original measurement of grams had 4 significant figures, so we need to round our answer to the same number of sig figs.

For the number we calculated, that is the thousandth place. The 1 in the ten thousandth place tells us to keep the 0 in the thousandth place.

[tex]1.040 \ mol \ N[/tex]

There are about 1.040 moles of nitrogen in 14.57 grams.

hi can someone pls help me it’s important i’m studying for my finals

Answers

Answer:

i think the answer is D)

but u should ask the another person too:)

It’s either b or d because the other ones don’t sound right

pls helpppp
Is the law of conservation of mass observed in each equation?

1. 2KClO3=2KCl+3O2

2. CaCO3+2HCl=CaCl2+H2O+CO2

Answers

Answer:

its c my guy

Explanation:

Other Questions
Please help! I will give thanks and brainliest if possible! At Breakfast Break, 2 eggs and 1 sausage patty cost $2.23 and 3 eggs with 2 sausage patties cost $3.76. Assuming that these amounts only pay for the eggs and sausage, how much does one sausage patty cost? a pulley is used to lift a 2000 N safe over frosty's head. the safe is lifted 6m in 4s by Rudolph. how much power did Rudolph use? what does hi mean in spanish -8t = 64Answer:t = ?Answer the ? Mark pls How did technology contribute to the expansion of European power through imperialism? Hey guys can one of you help me pls its only one small question Does (3,4) satisfy the equation-5x + 2y = 23? aA stone 'X' of mass 2 kg is at the height of 2 m from the ground levelAnother similar stone 'Y' of mass 4 kg is at the height of 4 m from the groundlevel. What is the difference between their potential energy?un minutes Calculate The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) slope of 2,11 and 5,2 Hey guys please help!! What is the definition of fourteen points? breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Why did debates among civil rights activists increase after 1965? What were the causes and effects of these debates? (Look into SNCC, CORE, Black Power, and the SCLC, Stokeley Carmichael, Huey Newton &/or Bobby Seale) 1 1