Original DNA is ATCG and Mutated DNA is ATGGThis is a point mutation, specifically a substitution mutation. In this case, the original cytosine (C) in the second position has been replaced with a guanine (G).
What is DNA ?Deoxyribonucleic Acid (DNA) is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and some viruses. DNA is composed of two strands of nucleotides twisted into a double helix and connected by hydrogen bonds. Each strand is composed of four different types of nucleotides: adenine (A), thymine (T), cytosine (C), and guanine (G). The information contained within DNA is transferred from one generation to the next by a process of replication.
To learn more about DNA
https://brainly.com/question/16099437
#SPJ1
FILL IN THE BLANK. Axon terminals __________.
are clusters of enlarged endings of an axon that may contain neurotransmitters
are continuous with the endomysium
are the same as the sarcoplasmic reticulum
are the key structures involved in eccentric contraction of a skeletal muscle
conduct impulses into the deepest region of muscle fibers
Answer: Axon terminals are clusters of enlarged endings of an axon that may contain neurotransmitters.
Axon terminals are clusters of enlarged endings of an axon that may contain neurotransmitters.
At the termination of axons, there are little swellings called axon terminals. Neurotransmitters are often kept there to facilitate communication with other neurons via their synapses, which are typically found at these locations.
These terminals are important for transmitting signals between neurons or from neurons to other cells. They release neurotransmitters, which are chemical messengers that transmit signals across a synapse, or the space between two cells.
The neurotransmitters bind to receptors on the target cell, causing a response. Thus, axon terminals play a crucial role in communication within the nervous system.
To know more about axon terminals here:
https://brainly.com/question/28234182#
#SPJ11
a late nineteenth century technique to treat trigeminal neuralgia was to inject alcohol into the trigeminal ganglion, which destroys all of the sensory fibers in the ganglion. once the procedure was successfully implemented, the patient would:
This would result in an alleviation of their symptoms, such as severe facial pain, numbness, and paralysis.
The late nineteenth-century technique to treat trigeminal neuralgia was to inject alcohol into the trigeminal ganglion, which would destroy all of the sensory fibers in the ganglion. Once the procedure was successfully implemented, the patient would experience a complete loss of sensation in the trigeminal nerve.
Trigeminal neuralgia is an excruciating condition of the face. In this condition, the trigeminal nerve, which is responsible for sensory nerve function in the face, becomes inflamed. Trigeminal neuralgia is characterized by a severe and sharp pain in the face, which can be triggered by routine activities like speaking, brushing the teeth, or eating.
The trigeminal ganglion is a collection of nerve cell bodies that sense pain, temperature, touch, and pressure in the face's skin and mucous membranes.
As a result, injecting alcohol into the trigeminal ganglion would destroy all of the sensory fibers in the ganglion, resulting in numbness and pain relief. Therefore, the pain is likely to have been relieved at least temporarily after alcohol was injected into the trigeminal ganglion.
Therefore, the answer is: "The pain is likely to have been relieved at least temporarily after alcohol was injected into the trigeminal ganglion."
Learn more about Trigeminal neuralgia:
https://brainly.com/question/14200553
#SPJ11
A particle that is 1000 mm with traveling in a stream with a velocity of 10,000mms
The kinetic energy of the particle is approximately 26.18 gigajoules (GJ).
How to find the kinetic energy of the particle?
To convert the length of the particle from millimetres (mm) to meters (m), we divide by 1000:
Length of particle = 1000 mm / 1000 = 1 m
The velocity of the particle is given as 10,000 m/s.
We can use the equation for kinetic energy (KE) to calculate the energy of the particle:
[tex]KE = 1/2 * m * v^2[/tex]
where m is the particle's mass and v is its velocity.
To calculate the mass of the particle, we need to know its density. Let's assume it has a density of [tex]1 g/cm^3.[/tex]
The volume of the particle is:
[tex]V = (4/3) * pi * r^3[/tex]
where r is the radius of the particle. We know the length of the particle is 1 m, so the radius is:
r = 1/2 = 0.5 m
Substituting the value of the radius into the equation for the volume:
[tex]V = (4/3) * pi * (0.5)^3 = 0.5236 m^3[/tex]
The mass of the particle is:
m = density * volume[tex]= 1 g/cm^3 * 1000 kg/m^3 * 0.5236 m^3 = 523.6 kg[/tex]
Substituting the values of mass and velocity into the equation for kinetic energy:
[tex]KE = 1/2 * m * v^2 = 1/2 * 523.6 kg * (10,000 m/s)^2 = 26.18 GJ[/tex]
Therefore, the kinetic energy of the particle is approximately 26.18 gigajoules (GJ).
To learn more about kinetic energy, visit:
https://brainly.com/question/30910516
#SPJ1
Submit your 750-word biography of a leading individual in the Industrial Revolution.
Industrial Revolution Biography
George Washington gave the Continental Army instructions during the American Revolution War (1775–1783).Following to stepping in as the nation's leader (1789 to 1797), he rapidly was liable for another army in 1798.Prior to the Revolutionary War, he participated inside the Virginia Volunteer Military & engaged in combat with the British forces, gaining military command and strategy.
The Industrial Revolution was being led by who?Many of the technical and architectural improvements that characterized the Industrial Revolution were developed in Britain, where the movement got its start.By the middle of the seventeenth century, She was the most prosperous country in the world, ruling a vast trading empire that included colonies in the Americas and the Caribbean.
Who were the major figures in industry?By today's standards, the wealth of John D. Rockefeller, Lucius Vanderbilt, Henry General motors, and Andrew Carnegie will be measured inside the hundreds of trillions of dollars, far surpassing that of tech titans like Elon, Bill Gates, Zuckerberg, and even Bezos, the world's richest person as of 2019.
To know more about George Washington visit:
https://brainly.com/question/14598321
#SPJ1
6-2 assume that the disease illustrated with the following pedigree is due to the phenotypic manifestation of a rare recessive allele of an autosomal gene that is paternally imprinted. a. what would you predict is the genotype of i-1?
Based on the pedigree, we can predict that i-1 has a genotype of heterozygous (i.e., the rare recessive allele is present in one of the homologous chromosomes).
Given that the disease shown in the pedigree is due to the phenotypic expression of a rare recessive allele of an autosomal gene that is paternally imprinted. Thus, i-1 may be a carrier of the disease since he does not express the phenotype associated with the disease. Therefore, the genotype of i-1 should be h/H, where h is the recessive allele and H is the dominant allele.
Imprint refers to the pattern of gene expression in which an allele is expressed or silenced based on its parent of origin. Imprinting is often associated with a single, differentially methylated CpG site in the promoter or near the promoter of the imprinted gene. Imprinting can occur in both males and females and applies to both autosomes and sex chromosomes.
However assuming the disease illustrated with the following pedigree is due to the phenotypic manifestation of a rare recessive allele of an autosomal gene that is paternally imprinted.
To know more about genotype please visit :
https://brainly.com/question/30460326
#SPJ11
(URGENT HELP PLEASE) Which of the following does NOT support the theory of natural selection? *
There are species that live in North America that are not found in Australia
Humans have small bones at the end of our spine that resemble tail bones in other animals
Prehistoric mastodons are similar to today's elephants
Species that are similar to each other tend to live near each other
Answer:
arti nya apa wkwk
Explanation:
saya ngk bisa bahasa inggris
As the forensic scientist on a poisoning case, Aaliya is conducting a color test on a sample from the victim. The victim was reportedly suffering from
headaches and nausea before a respiratory failure occurred. Which poison is Aaliya MOST likely testing for?
O A. arsenic
OB. cyanide
OC. strychnine
O D. ricin
Explanation:
Based on the symptoms mentioned, the poison that Aaliya is most likely testing for is B. cyanide. Cyanide poisoning can cause headache, nausea, and respiratory failure, which are the symptoms the victim reportedly experienced. Arsenic and strychnine poisoning can also cause headaches and nausea, but respiratory failure is not a common symptom. Ricin poisoning can cause respiratory symptoms, but it does not typically cause headaches and nausea.
A 1 mL volume of master mix with a 10M concentration of substrate has been prepared in order to run an enzyme kinetics assay. The required concentrations for the assay are 5M,1M,0.5M and 0.25M. The concentrations are to be prepared using the master mix and protein-free sterile water. What volume of master mix should be used to make 100 ul of the 0.5M concentration? a. 0.5ul b. 500ul c. 5 ul d. 50ul
The volume of the master mix of enzyme required to make 100 ul of a 0.5M concentration solution is 5 ul.
How can you determine an enzyme's concentration?A simple time-course experiment paired with enzyme titrations can be used to find the ideal enzyme concentration and assay timing. The linear phase of the reaction should be used to evaluate HAT activity in a perfect assay.
To calculate the volume of master mix required to make 100 ul of a 0.5M concentration solution, we can use the dilution formula: C1V1 = C2V2
Substituting the given values, we get:
10M x V1 = 0.5M x 100 ul
V1 = (0.5M x 100 ul) / 10M
V1 = 5 ul
To know more about enzyme visit:-
brainly.com/question/14953274
#SPJ1
Taking CO2 and turning it into C6H12O6 is what type of chemical reaction (catabolic/anabolic, endergonic/exergonic). Justify your answer.
In contrast, catabolic reactions break down complex molecules into simpler ones, and are generally exergonic, meaning they release energy. For example, when glucose is broken down through cellular respiration
Briefly defined, what is cellular respiration?Through the process of cellular respiration, which involves combining oxygen with food molecules, organisms direct the chemical energy contained in these substances toward life-sustaining processes while excreting carbon dioxide and water as waste, they are able to maintain their own existence.
What is the purpose of cellular respiration?In order to release energy in the form of ATP, sugar must be broken down in the presence of oxygen within the mitochondria of organisms (both animals and plants). This process is known as cellular respiration. As waste products, this process emits water and carbon dioxide.
To know more about cellular respiration visit:
https://brainly.com/question/16192136
#SPJ1
HELP ME
Your brain, spinal cord, and nerves make up your nervous system. Together they control all the workings of your body. When something goes wrong with any part of your nervous system, you can have trouble moving, speaking, swallowing, breathing, or learning. You can also have problems with your memory, senses, or mood. There are more than 600 neurologic diseases and disorders, and they have just as many causes. Some are caused by faulty genes, like Huntington’s disease or Muscular dystrophy. Others may be caused by degeneration, like Parkinson’s or Alzheimer’s. Disorders in children may be caused by problems with how the nervous system developed, like with spina bifida. Even others, like strokes or meningitis, can be caused by illness or injury.
Research one of the nervous system disorders you find on the website listed below, or any other that you find. Design a pamphlet or brochure about the disorder and one medication or treatment method used to help those that have the disorder. Include who can be affected by the disorder, how common or uncommon it is and how researchers think the medication or treatment will help. Explain its general effectiveness, and any side effects the medication or treatment may cause. Remember to cite all your sources.
The Parkinson's disease is the nervous system disorder that has been researched on here.
How does the Parkinson's disease act on an individual?Parkinson's disease is a degenerative disorder that affects the nervous system and is characterized by tremors, stiffness, and difficulty with movement. According to the Parkinson's Foundation, over 10 million people worldwide live with this disorder, and approximately 60,000 Americans are diagnosed with it each year. The exact cause of Parkinson's disease is unknown, but it is believed to be a combination of genetic and environmental factors.
One medication used to treat Parkinson's disease is levodopa. Levodopa is a medication that increases the level of dopamine in the brain, which is a neurotransmitter that helps regulate movement. Dopamine levels are typically low in individuals with Parkinson's disease, causing the motor symptoms associated with the disorder. Levodopa is a precursor to dopamine and helps increase dopamine levels in the brain.
Levodopa is considered the gold standard treatment for Parkinson's disease, and studies have shown it to be effective in improving motor symptoms, such as tremors and rigidity. However, it is not a cure, and the progression of the disease cannot be halted by this medication.
There are several side effects associated with levodopa use, including nausea, vomiting, dizziness, and dyskinesia, which is an involuntary movement disorder. Long-term use of levodopa can also lead to motor complications, such as fluctuations in response to the medication and dyskinesia.
It is essential to work closely with a healthcare provider when taking levodopa or any other medication for Parkinson's disease to monitor its effectiveness and any potential side effects.
In conclusion, Parkinson's disease is a common neurodegenerative disorder that can be managed with medication such as levodopa. While it is not a cure, it can help improve motor symptoms and quality of life for those with the disorder. However, it is important to be aware of the potential side effects and work closely with a healthcare provider to monitor their use.
Read more on Parkinson's disease here:https://brainly.com/question/5126740
#SPJ1
1) A child having a tantrum in a department store screams louder the more upset his parent gets. This is example of:
A)Negative Feedback
B)Positive Feedback
C)Survival of the fittest
D)Dynamic equilibrium
Answer:
A.
Explanation:
I think this is negative feedback because it says that the child continues to scream yet also screams louder the more that the parents seem to be upset with them screaming and the child’s tantrum.
Isaiah is trying to think of a nickname for the hadalpelagic zone, to help him remember its distinguishing characteristics. What is the BEST nickname for this purpose? A. trench B. underworld C. bioluminescent D. floor
A. trench would be the BEST nickname for the hadalpelagic zone, as it is the most commonly used term for this deep oceanic zone.
What is Hadalpelagic Zone?
The Hadalpelagic Zone, also known as the hadal zone, is the deepest part of the ocean, extending from a depth of about 6,000 meters (19,700 feet) to the bottom of the ocean floor. The name "hadal" comes from Hades, the underworld in Greek mythology, reflecting the extreme depth and darkness of this zone.
The hadalpelagic zone is characterized by a number of extreme environmental conditions, including high pressure, low temperature, and complete darkness. The pressure at the bottom of the hadalpelagic zone can exceed 1,000 times atmospheric pressure at sea level, which is enough to crush most organisms. Despite these harsh conditions, the hadalpelagic zone is home to a variety of specialized organisms, including deep-sea fish, crustaceans, and microbes, that have adapted to life in this extreme environment.
The hadalpelagic zone includes the deepest parts of the ocean, such as ocean trenches, which are long, narrow, and steep depressions in the ocean floor. These trenches are one of the most distinguishing characteristics of the hadalpelagic zone, so using the nickname "trench" would help Isaiah remember this feature and associate it with the hadalpelagic zone.
Learn more about Hadalpelagic Zone from given link
https://brainly.com/question/13733052
#SPJ1
Click the draw structure button to launch the drawing utility. Draw the product of the following reaction
An alkane with two less carbons than the initial substance is the end result of the reduction reaction.
Click the "draw structure" button to start the drawing tool and draw the structure. Add two less carbon atoms to the beginning material using the drawing tool, being sure to connect the hydrogen atoms to the carbon atoms to create an alkane. The delocalization of electrons within a molecule or ion between two or more adjacent atoms with the same connectivity is referred to as resonance in chemistry. When the electronic structure of a molecule or ion can be described by two or more equivalent resonance structures, also known as Lewis structures, that only differ in the arrangement of electrons, resonance has occurred.
Make sure the hydrogen atoms in the product structure are coupled to the carbon atoms since reduction reactions typically entail adding hydrogen atoms or taking them away.
The product's structure is finished once all of the atoms are suitably joined.
Learn more about alkane here
https://brainly.com/question/31061177
#SPJ1
Why do we not see red, orange, and yellow colors in leaves during most of the year? a. During the rest of the year, the tree isn't conserving water. b. Accessory pigments are masked by chlorophyll most of the year. c. Cold weather is needed to stimulate accessory pigments to show off their c colors. d. The photoperiod needs to shorten in order to trigger the accessory pigments.
Because of its abundance, chlorophyll covers other pigments like xanthophyll and carotenoids that are yellow and orange in colour. Other pigments can be observed in leaves as the amount of chlorophyll decreases.
Why are red, orange, and yellow colours absent from leaves for the majority of the year?You could believe that the orange and yellow hues, or pigments, are only present in leaves during the fall, but in reality, they are present all year long; we can just not see them because of the intense green pigment that is also present in leaves hides them.
Why are the yellow and orange colours not visible during the summer?As I've mentioned in a number of my earlier pieces, leaves yellow and orange hues come to light when chlorophyll, the pigment that gives leaves their green appearance, is lost from the leaf. These pigments were hidden by chlorophyll in the summer.
to know more about pigments here:
brainly.com/question/24193152
#SPJ1
Green construction involves following building practices that
adhere to the principles of
O regeneration
O depletion
O sustainability
O recycling
Green construction involves following building practices that adhere to the principles of sustainability.
What is green construction?
Green construction is a building practice that promotes sustainability and reduces environmental impact. It involves techniques such as energy-efficient designs, use of renewable energy, and incorporation of recycled materials. The goal is to create structures that are environmentally responsible and promote a healthy living environment, reducing the overall impact of the construction industry on the environment.
This includes reducing environmental impact, minimizing resource depletion, promoting regeneration of natural systems, and maximizing the use of recycled materials. Sustainable building practices can involve a variety of techniques, such as energy-efficient designs, use of renewable energy sources, and incorporation of recycled materials into construction.
The goal of green construction is to create structures that are environmentally responsible, energy-efficient, and promote a healthy living environment. By following these principles, green construction can help to reduce the overall environmental impact of the construction industry and promote a more sustainable future.
To know more about construction visit :-
https://brainly.com/question/25795065
#SPJ9
How is the dna in a prokaryote different from the dna in a eykaryote ?
Answer:
Prokaryotes and eukaryotes differ in their DNA structure and location. Prokaryotes, such as bacteria, have a single circular chromosome that is not enclosed in a nucleus. In contrast, eukaryotes, such as humans, have multiple linear chromosomes enclosed in a membrane-bound nucleus. Additionally, eukaryotes have specialized organelles, such as mitochondria and chloroplasts, that contain their own DNA. Prokaryotes lack these organelles. Furthermore, eukaryotes have more complex DNA packaging, involving histones and chromatin, to allow for more precise regulation of gene expression. In summary, the DNA in prokaryotes is simpler in structure, location and packaging compared to eukaryotes.
Explanation:
Answer:
B
Explanation:
I'm going to be very straigthtforward as I do not want to confuse you. Inside a prokaryotic cell, the DNA foats around in the Cytoplasm, but in a Eukaryotic Cell, that DNA is enclosed in the nucleus. Therfore, the correct answer is B.
I put a lot of effort into my answers, so I would really appreciate a brainliest. Thanks!
Question 6 of 10
Where is the atmosphere the most dense?
A. At the top
B. At the bottom
C. At the coldest part.
D. At the warmest part.
Waves ___ with one another when they travel in close proximity to one another
Waves interact with one another in a variety of ways when they travel in close proximity to each other.
One of the most common types of wave interaction is interference, where two waves combine to form a new wave pattern. When waves interfere constructively, their amplitudes add together, creating a larger wave. Conversely, when waves interfere destructively, their amplitudes cancel out, creating a smaller wave. Waves can also diffract or bend around obstacles, refract or change direction when they pass through a medium with a different density or speed, and reflect off surfaces. The precise way in which waves interact with one another depends on a variety of factors, including the type of wave, the frequency, and the angle of incidence.
For such more question on Waves
https://brainly.com/question/1712668
#SPJ4
Select the correct answer from each drop-down menu. an ecosystem now receives far less rain than it used to. the weather also became drier and hotter. over time, plants with structures that helped them to conserve water became more prevalent than plants that didn’t have those structures. from this information, we can conclude that the plants developed because of .
The plants developed structures that helped them conserve water due to natural selection, specifically the process of adaptation. Here option A is the correct answer.
Natural selection is a mechanism of evolution that occurs when organisms with certain advantageous traits survive and reproduce better than others in their environment, leading to the gradual emergence of new traits in a population over time.
The reduction in rainfall, combined with drier and hotter weather, created a selective pressure that favored plants with structures that helped them conserve water.
Over time, these plants became more prevalent in the ecosystem because they were better adapted to the changing environmental conditions. This is an example of adaptation through natural selection, where the traits that confer a survival advantage become more common in the population over generations.
Complete question:
Select the correct answer from each drop-down menu. an ecosystem now receives far less rain than it used to. the weather also became drier and hotter. over time, plants with structures that helped them to conserve water became more prevalent than plants that didn’t have those structures. from this information, we can conclude that the plants developed because of .
A - Natural selection
B - Genetic drift
C - Gene flow
D - Mutation
To learn more about natural selection
https://brainly.com/question/2725702
#SPJ4
Does the carbon cycle in this diagram appear to be in balance or to be in balance
Explain where the moon should be in comparison to the Earth and Sun for each of the phases.
New Moon:
Between the sun and the earth
Crescent Moon:
Quarter Moon:
Gibbous Moon:
Full Moon:
hope this helps
I add a song too.
explain how independent orientation of chromosomes at metaphase i, random fertilization, and crossing over contribute to genetic variation in sexually reproducing organisms.
New sets of chromosomes with different allele combinations are produced by crossing over during prophase with independent assortment during anaphase. Randomly fertilizing the gametes created by meiosis also contributes to genetic variety.
In plain English, what are chromosomes?a component located in a cell's nucleus. DNA and proteins arranged into genes make up a chromosome. 23 chromosome pairs are typically present in each cell.
What is the purpose of a chromosome?Genomic information is transported from cell to cell via chromosomes, which are threadlike structures consisting of protein and a single DNA molecule. Chromosomes are found in the cell nucleus of all living things, including plants, animals, and humans.
To know more about chromosome visit:
https://brainly.com/question/1596925
#SPJ1
Identify the stages of mitosis
The stages of mitosis described are as follows:
Prophase MetaphaseAnaphaseTelophaseWhat are the stages of mitosis?The events described refer to the different stages of mitosis, which is the process by which a eukaryotic cell divides its nucleus and genetic material to produce two identical daughter cells.
The events occur in the following stages of mitosis:
The DNA molecules are progressively shortened and condensed by coiling, to form visible chromosomes during the prophase stage of mitosis.
The chromosomes move and line up down the middle of the cell during the metaphase stage of mitosis. This alignment of chromosomes is known as the metaphase plate.
The chromosome pairs split and separate during the anaphase stage of mitosis. The sister chromatids, which make up each chromosome, are pulled apart by spindle fibers and move toward opposite poles of the cell.
The chromosomes are pulled to opposite ends of the cell during the telophase stage of mitosis. The nuclear membrane reforms around each set of chromosomes to form two separate nuclei. Finally, the chromosomes uncoil and return to their less-condensed state, completing the process of mitosis.
Learn more about the stages of mitosis at: https://brainly.com/question/30271486
#SPJ1
A person's blood alcohol content (BAC) depends ONLY on how much alcohol they've consumed.
O A.
O B.
True
False
Explanation:
False. A person's blood alcohol content (BAC) depends on several factors in addition to how much alcohol they've consumed, including their weight, gender, age, metabolism, and the amount of food in their stomach. Additionally, the rate at which alcohol is consumed can also affect BAC.
Which of the following are examples of Swedish massage? Select all that apply
pressing points on the hands, feet, and ears to promote healing in other parts of the body
massaging in order to flush the muscle tissue of lactic acid, uric acid, and other metabolic wastes that create tiredness
using the tips of the fingers to create a rapid, trembling movement as they move back and forth on the skin and apply light pressure
Light and very slow massage that uses fingertips against the skin in elliptical motions in the areas of superficial ganglia
Swedish massage uses fingertips against the skin in elliptical motions in the superficial ganglia-targeted regions.
What is the name of a Swedish massage?Swedish massage is one of the massage styles that is most commonly offered. Some refer to it as a conventional form of therapy. By releasing muscular tension, the method seeks to encourage relaxation. Swedish massage is more suitable for those seeking to relax and relieve stress than deep tissue massage because it is gentler.
What are the five fundamental Swedish massage strokes?Swedish massage uses five fundamental strokes, though not all of them are applied to every part of the body: effleurage (stroking), petrissage (kneading), friction, tapotement (percussion), and vibration.
To know more about Swedish massage visit:-
https://brainly.com/question/31190037
#SPJ1
Trinucleotide repeat disorders are hereditary diseases caused by mutant genes containing an increased number of repeats of a DNA trinucleotide sequence. Which sequence(s) contain a trinucleotide repeat? Select all that apply.
a)...CACGGAAGAAGAAGAAGAAATAGAC...
b)...AGCGACAGCAGCAGCAGCAGCAAGT...
c)...TTCACTGTCACTGTCACTGTCACTGTCC...
d)...CACGGCGGCGGCGGCGGCATCGC...
e)...GGCAGGCAGGCAGGCAGGCAGGCTG...
Trinucleotide repeat disorders are hereditary diseases caused by mutant genes containing an increased number of repeats of a DNA trinucleotide sequence. Therefore, the correct option is a, c, and e.
Which sequence(s) contain a trinucleotide repeat?Trinucleotide repeat is a DNA sequence that is repeated several times in a row. A repeated sequence of three nucleotides that leads to a specific and consistent phenotype when it is repeated is known as trinucleotide repeats.Sequences containing a trinucleotide repeat are:
a) CACGGAAGAAGAAGAAGAAATAGAC, c) TTCACTGTCACTGTCACTGTCACTGTCC, and e) GGCAGGCAGGCAGGCAGGCAGGCTG.Learn more about trinucleotide: https://brainly.com/question/2898576
#SPJ11
which is not characteristic of the parasympathetic division of the ans? no rami communicantes long postganglionic axons terminal ganglia close to the target organ craniosacral preganglionic neuron cell bodies long preganglionic axons
No Rami Communicantes is not characteristic of the parasympathetic division of the ANS. The other three characteristics are all common to the parasympathetic division.
Parasympathetic division of ANS is one of the two divisions of the autonomic nervous system. This division is responsible for the activation of the body during a relaxed state.
The parasympathetic division of the ANS is characterized by having no rami communicantes. Parasympathetic fibers are normally not found on thoracic spinal nerves. Instead, they emerge from sacral spinal nerves S2 through S4 and from the vagus nerve (CN X).
The parasympathetic division, unlike the sympathetic division, does not have a chain of ganglia adjacent to the spinal cord, but rather has terminal ganglia located close to the target organ. The preganglionic fibers of the parasympathetic division are quite long, while the postganglionic fibers are quite short.
learn more about Parasympathetic division here:
https://brainly.com/question/14273387
#SPJ11
[Integrated Science] Set the skater into a simple back and forth motion as before on the first track that is a simple U shape and look at the Energy bar chart. Can you see how the rightmost bar labeled Total is remaining constant? The fact that it stays constant is a demonstration of the Law of...
The fact that the rightmost bar labeled Total remains constant during the simple back-and-forth motion of a skater on a U-shaped track is a demonstration of the Law of Conservation of Energy.
What is the Law of Conservation of Energy?
According to the Law of Conservation of Energy law, energy can neither be created nor destroyed, but it can be transformed from one form to another.
In the case of the skater, the total energy of the system remains constant because the kinetic energy of the skater is converted to potential energy as he/she moves up the track, and the potential energy is then converted back to kinetic energy as he/she moves down the track.
Therefore, the total energy of the system (kinetic energy + potential energy) remains constant, and energy is conserved.
Learn more about the Law of Conservation of Energy at: https://brainly.com/question/166559
#SPJ1
Fill in the table with two pros and two cons of the corn farmer switching to the genetically modified insect-resistant corn
The two pros and two cons of the corn farmer switching to the genetically modified insect-resistant corn are shown below:
PROS
1.) Genetically modified (GM) crops have been shown to be safe via study and usage, and they may potentially improve the safety of popular meals.
2.) GMO crops reduce food prices while increasing nutritional value, hence reducing global hunger.
CONS
1) Human clinical trials have not established that genetically modified (GM) crops are safe for human consumption.
2) Plant genetic modification may result in changes to the food supply that introduce toxins or provoke allergic responses.
The Genetic Literacy Project reports that "the most recent data from the International Service for the Acquisition of Agri-biotech Applications (ISAAA) show that more than 18 million farmers in 29 countries, including 19 developing nations, planted over 190 million hectares (469.5 million acres) of GMO crops in 2019." According to the group, the crops are prohibited in a "majority" of European nations, as well as Russia. Nonetheless, most nations that prohibit the cultivation of Transgenic crops accept their import. Europe, for example, buys 30 million tonnes of GMO maize and soy animal feeds each year.
Learn more about genetically modified corn:
https://brainly.com/question/29978368
#SPJ4
which organ of the body did the film use as an example of how evolutionary processes can work over time to modify an existing trait to have a different appearance and/or function?
The film used the lungs as an example of how evolutionary processes can work over time to modify an existing trait to have a different appearance and/or function.
What is evolution?
The process by which different types of living organisms have developed and diversified from earlier forms during the history of the earth is known as evolution. Evolution is the gradual process of change that occurs over time, resulting in the diversity of living things on the planet. Through genetic variations that arise naturally, evolution occurs.
How does the lung demonstrate the evolutionary process?
As we know, the lung is a respiratory organ in many animals. The structure and function of lungs vary widely among different animals due to the evolution of lungs. The lungs of mammals are complex structures that allow for the exchange of oxygen and carbon dioxide, while the lungs of birds are even more efficient. Because the birds require a lot of energy, they have adapted to have an even more efficient respiratory system.
As a result, it is a good example of how evolutionary processes can work over time to modify an existing trait to have a different appearance and/or function.
To know more about "evolution" refer here:
https://brainly.com/question/13492988#
#SPJ11