Normal cells responds to contact inhibition. When they come into contact with other cells, they stop moving and dividing. This keeps the cell contained within their own tissues. How did the mutated (cancer) cells show the evidence that they do not respond to contact inhibition?

Answers

Answer 1

Answer:

Cancer is basically a disease of uncontrolled cell division. Its development and progression are usually linked to a series of changes in the activity of cell cycle regulators. For example, inhibitors of the cell cycle keep cells from dividing when conditions aren’t right, so too little activity of these inhibitors can promote cancer. Similarly, positive regulators of cell division can lead to cancer if they are too active. In most cases, these changes in activity are due to mutations in the genes that encode cell cycle regulator proteins.

Explanation:

Answer 2

The mutated (cancer) cells show the evidence that they do not respond to contact inhibition because there is no stopping of division of the cells.

Normal cells VS mutant cells

Normal cells show response to contact inhibition when they come into contact with other cells, so they stop moving and dividing.

While on the other hand, The mutated (cancer) cells show the evidence that they do not respond to contact inhibition because there is no stopping of division of the cells so we can conclude that no stopping of division occurs which is the evidence that the cancer cells show no response to contact inhibition.

Learn more about mutation here: https://brainly.com/question/17031191


Related Questions

The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons

Answers

Answer: transfer of electrons

Explanation:

How many chlorine atoms are there in the molecule NiCl2

Answers

Answer:

2, that’s what the 2 means.

Explanation:

Are gender traits completely a result of societal expectations?

Answers

Answer:

No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.

What are 3 lines of evidence that corroborate the theory of evolution?

Answers

Answer:

Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.

Explanation:

I majored in Biology

correct order of events during the process of nucleosynthesis?

Answers

Answer:

hydrogen nucleus formed, isotope of hydrogen, tritium formed, helium nucleus formed

Explanation:

Answer:

A

Explanation:

took the quiz

1. Carbon is a very important element in biology. What are some of the reasons that organisms need carbon? please help me

Answers

Answer:

"All living orgasms contain carbon and all virtual molecules in the body contain carbon, sugar, DNA, proteins, Fats..."

Explanation:

Hope this helps :)

Which ecosystem most likely has the greatest biological diversity and therefore the highest sustainability A. A tank that includes several goldfish B. Tundra region that has many penguins C. A pine tree in which three groups of birds live D. A rainforest that has many different types of plants and animals

Answers

Answer:

definitely D because a rainforest is extremely vast when it comes to different species

Explanation:

brainliest plz?

The ecosystem which is most likely has the greatest biological diversity and therefore the highest sustainability is a rainforest that has many types of plants and animals. Therefore, the correct option is D.

What is ecosystem?

An ecosystem refers to the biological community where the biotic as well as the abiotic components interact with each other and influence each other.

It encompasses all the living organisms in a specific area as well as physical and chemical factors that shape their environment such as air water soil climate and environment. They play an important role in functioning the earth's biosphere, as they provide a range of essential services.

The study of ecosystem and interaction between is components is referred to as ecology. Hence, the correct option is D.

For more details regarding ecosystem, visit:

https://brainly.com/question/15011558

#SPJ6

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

When is carbon dioxide released during aerobic cellular respiration?

Answers

Answer:

I hope this helps and rate it if its right

Explanation:

I hope this helps and rate it if its right

What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]

When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.

How could one determine if two
unidentified organisms share a common
ancestor?

Answers

Answer:

Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.

Explanation:

DNA

They can look at the DNA it's the most common one.

There are 4 pieces of evolution and they are

Fossils , Geography , Embryos / DNA , Anatomy

Fossils: Physical remains of species , Determine age, location,  environment

Deeper layers = older

Geography: Proves species share common  ancestors, depending on where

they live

DNA: BEST evidence because it’s the  MOST ACCURATE

Similarities in the early stages of  development

Similarities in DNA

More similarities = closely related

More differences = not related

Anatomy: Compare body parts of different  species to see how they evolved

3 different structures:

Homologous (same structure,  different function)

Analogous (similar structure,  different organisms)

Vestigial (body parts that no  longer serve a purpose)

All of that are in evolution

Hope it helped! ( Gave u my biology notes :D)

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

(GIVING BRAINLIEST!!)


James made the following table to compare the common characteristics of planets. Which of the following would best replace X?


A) Asteroids

B) Comets

C) Moons

D) Stars

Answers

Answer: moons

Explanation:

Mars and Neptune both have moons

Answer:

hi answer is moons

Explanation:they have moons :)

what is reduced soil?

Answers

Answer:

A chain of reactions is initiated upon soil flooding leading to reduced (low) soil redox potential (Eh, mV) conditions. These reactions include physical, chemical and biological processes that have significant implications for wetland plants.


Physical processes include restriction of atmospheric gas diffusion in the soil leading to depletion of soil oxygen and accumulation of carbon dioxide [4,5]. ... This process leads to oxygen depletion and reduction in soil oxidation reduction potential (Eh) followed by a chain of soil chemical changes.

Which model below shows a prokaryotic cells?

Answers

Answer:

Modle two as it is singular, simple with a flagellum

Explanation:

When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:

A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.

Answers

Answer:

A

Explanation:

the northern hemisphere is the opposite from the southern hemisphere

Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.

Why are the seasons reversed in each hemisphere?

The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.

Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.

Learn more about seasons, here:

https://brainly.com/question/12028829

#SPJ2

Which of the following processes cycles matter through different parts of an ecosystem?
More than one answer may be correct.
1. the nitrogen cycle
2. the water cycle
3. the carbon cycle

Answers

Answer:

the nitrogen cycle, the water cycle, and the carbon cycle

Explanation:

The water, carbon, and nitrogen cycles move nutrients through the different parts of an ecosystem. Water moves through organisms and the environment in different phases. Carbon moves through an ecosystem in carbon dioxide, minerals, and organic compounds. Nitrogen moves through an ecosystem in nitrogen gas, ammonium, nitrates, and organic compounds.

The biogeochemical cycle is a pathway that circulates the chemicals through the abiotic and the biotic factor. The nitrogen, water, and carbon cycle through various regions of an ecosystem.

What is a biogeochemical cycle?

The biogeochemical cycle is the movement of the chemicals and compounds of carbon, nitrogen, and water in the biosphere (biotic) and the atmosphere, lithosphere, and hydrosphere (abiotic) spheres of the earth.

These cycles move the nutrient through different spheres in the form of inorganic and organic compounds. It is an essential part of the ecosystem as they regulate the flow of the natural elements.

Therefore, option 1. nitrogen cycle, option 2. water cycle, and option 3. carbon cycle move through various parts of an ecosystem.

Learn more about biogeochemical cycles here:

https://brainly.com/question/1204069

#SPJ2

What is the function of a phospholipid bilayer

Answers

Answer:

Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.

Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.

What two elements of weather are affected by air masses

Answers

Answer:

The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.

Cold fronts and warm fronts

how does the respiratory and digestive system work together to maintain homeostasis

Answers

You have four main types of tissues: epithelial, nervous, muscle, and connective tissue. Epithelial tissue covers the outside of the body. It also lines organs and cavities. Nervous tissue sends electrical signals. Muscle tissue helps you move. Connective tissue joins bones and cushions organs.
When groups of tissues work together, they are called organs. Some
examples of organs are the heart, lungs, skin, and stomach. When organs work together, they are called systems. For example, your heart, lungs, blood, and blood vessels work together. They make up the circulatory system.
There are eleven systems in the human body: muscular system, respiratory system, digestive system, integumentary system (skin), skeletal system, circulatory (or cardiovascular) system, excretory (or urinary) system, reproductive system, nervous system, lymphatic system, and endocrine system. Each system has a special job.
All of your body systems have to work together to keep you healthy. Your bones and muscles work together to support and move your body. Your respiratory system takes in oxygen from the air. It also gets rid of carbon dioxide.
1
2
3
4
5
6
Your digestive system absorbs water and nutrients from the food you eat.
Your circulatory system carries oxygen, water, and nutrients to cells throughout your body. Wastes from the cells are eliminated by your respiratory system, your excretory system, and your skin. Your nervous system controls all these activities with electrical impulses. If any system in your body isn't working properly, other systems are affected.
Think of your body as a building. A building has a plumbing system, a heating system, a cooling system, an electrical system, and a support system. If any system in a building breaks down, other systems can be affected.
As one example, think about a building's electrical system. Suppose a mouse chewed through an electrical wire to a furnace. Without electricity, the heating system would not work. If this happened in very cold weather, the plumbing system could be affected. Water pipes might freeze and burst. If a lot of water leaked into the building's walls, its support system would be damaged. Like a building's systems, your body's systems have to work together.
HERE IS UR ANSWER MATE!.....

The respiratory system brings oxygen into the lungs when you breathe. The digestive system breaks food down into nutrients such as glucose. Now the circulatory system enters the picture. It transports glucose and other nutrients from the digestive system to the cells.

HOPE IT HLPS UH WELL

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Read more about organisms

https://brainly.com/question/25832580

Answer:

While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.

Explanation:

The answer explains itself. It is accurate information. :) Have a good day!

how do gray whales migrate?

Answers

Answer:  Grey whales travel 12,000 miles round-trip from their feeding grounds in the Arctic to calve and breed in the Baja lagoons, and then back again.

Explanation:

please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?

Answers

Answer:

A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.

how do vital signs allow medical professionals to assess a patient's physiology and overall health

Answers

they measure the pulse rate and blood pressure of a patient, these can  help to determine if a patient has any diseases of the blood or if they are under stress.

A molecule of oxygen gas contains two:
O molecules
O elements
O atoms

Answers

Answer:

O atoms

Explanation:

:)))

A molecule of oxygen gas contains two atoms of oxygen bonded together.

Answer: your answer will be C

which layer of the earth is made out of melted metal?

Answers

The outer core. A molten nickle- iron alloy.

PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.​

Answers

It made it possible to actually see cells. Explanation: With the development and improvement of the light microscope, the theory created by Sir Robert Hooke that organisms would be made of cells was confirmed as scientist were able to actually see cells in tissues placed under the microscope.

Thank You so Much

your amazing have a great life

As scientists advise about potential risks due to climate change, many coastal areas are preparing for a higher risk of impact Predict
which of these has a greater impact on human health in coastal areas due to climate change.

Answers

Since the coast water is rising,it would be hard to find fresh water. The people would not be able to use the water,because it would be contaminated with bacteria. If all of the ice does melt,most of the fresh water will turn to salt water,and we would have to adapt to a new way of life. People would have to live on higher land,there would be no one to grow crops,and their would be no way that trees would survive,meaning we would not be able to breathe.The worst part of this all is that the Earth's temperature will sky rocket,and it will be so hot,the Earth will kinda be like a huge hurricane.(lol)

Hope this helped and good luck!

-Nea

Answer:

C.  Increased severity of tropical storms

Explanation:

Due to increased water temp and increased evaporation

How does the size of a bacterial cell compare with an animal cell?

Answers

Answer:

hope it helped

Explanation:

Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.

What biotic factors might affect a population of fish? Check ALL that apply.

predators
prey
light
bacteria

Answers

Answer:

Explanation: Abiotic factors for fish is water, temperature, amount of dissolved oxygen in water, etc. Penetration of sunlight is also important in fresh water habitat. Biotic factors are predators, disease causing organisms, organisms available as food, population density of competitors, etc.

Explanation:

Other Questions
Read the excerpt from Heart of a Samurai.Each of them was also given a metal stick, with four prongs on one end.Fork, the sailor said and showed them they should use it to eat the rice.The fishermen recited their prayer before eating. Itadakimasu I will humbly receive.Then Goemon said, It might be poison.What can readers infer based on details in the excerpt?A. Goemon likes new experiences.B. Goemon is not afraid of his rescuers.C. Goemon does not trust his rescuers.D. Goemon has used a fork before. -2x - 2y =-10 and 9x + 7y = 49 Realizeaz expansiunea atributelor scrise italic n versurile de mai jos, desprind n propoziii fraza obinut i indicnd felul acestora.Glasul ei limpedei neneles se aude.Va ROG E URGENT Determine the number of seconds in one week. how long does it take for ink to dry Define heart and its functions? Please answer 5 x (1/25) What is Pedigree?? Can someone help me i need this answer plzzzzzz Steph needs to help her parents put a fence around their pool. They want the fence to be square and want each side to measure 6 meters. They already have 10 meters of fencing. How many more meters of fencing should they buy? Take a trip beginning at 30 degrees S and 25 degrees E and go to 67 degrees N and 155 degrees W. In which country did you begin your journey? Where did it end? the presidential inauguration is free to watch with or without paying ror traditional tv service. Why is this important? Name 3 differences between a Civil pretrial procedures and Criminal pretrial procedures. Which gas is MOST abundant in Earths atmosphere?A.)methaneB.)oxygenC.)nitrogenD.)carbon dioxide Select the correctinswerWhich term is a term in this expression?-3x - 7(x + 4)A.-3B. 3xC.-7D. X+4 the Pythagorean theorem please help answer all the questions USPS charges a flate rate of $5.50 for the 1st pound of shipping, plus $1.35 for each additional pound. FedEx charges $8.00 for the 1st pound of shipping and $1.10 for each additional pound. How many pounds will it take for USPS and FedEx to cost the same? Describe the events that lead to Barty Gunliffe's accident What would you tip for a $22 meal if you wanted to leave 15%?$18.70$4.40$3.30$25.30 el choferLa abogada.La persona que corta el pelo.La persona que conduceLa gua turistica 3Regina writes the expression y +9.4Which expression is equivalent to the one Reginawrites?A (9.3 : 4) + yB 9+ y(3:4)C (y +9)(3-4)D None of these