Neurons that respond to specific types of lines are examples of:
A. figure detectors.
B. top-down processors.
C. feature detectors.
D. figure processors.

Answers

Answer 1

Answer:

C

Explanation:

Answer 2

Neurons that respond to certain types of lines are examples of feature detectors found in Option C. Neurons are the monomeric units of the nervous system that play an important role in transmission.

   

What is the importance of the neuron?

The neuron is a unit in which the message is transmitted from the neuron to another neuron, and this can be done by either chemical signaling or by electric signaling. The neuron receives sensory stimuli from the sensory organ and transmits them to the spinal cord.

Later, the message from the spinal cord is sent to the motor organs, and the whole pathway of the neuron signaling from the sensory to the motor organ is called the reflex arc. The neuron takes part in the signaling process so that the muscle can function, regulate the contraction relaxation, and perform many other functions.

Hence, neurons that respond to certain types of lines are examples of feature detectors found in Option C.

Learn more about the neuron here.

https://brainly.com/question/29462317

#SPJ5


Related Questions

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

which statement best describes the difference between the sympathetic and parasympathetic nervous systems?

Answers

Parasympathetic system calms you down lets all your organs have the same amount of oxygen delivered. The sympathetic system gets your muscles moving and makes you excited.

WILL GIVE BRAINLIEST

DNA molecules are the instructions to make what?

-proteins

-carbohydrates

-lipids

-plasmids

Answers

Answer:

A

Explanation:

DNA is used to make mRNA, which is then used alongside tRNA to make a polypeptide chain. This chain folds to make a protein.

using the count data and observational data you acquired calculate the number of cfus in the original sample

Answers

Answer:

cuales son los datos ?

Explanation:

cuales son los datos

The process by which organisms that are better adapted to their environment survive and reproduce more successfully than less well adapted
organisms do.
A. Artificial Selection
B.Evolution
С.Natural Selection
D.Adaptation

Answers

Answer:

C

According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

Explanation:

Answer:

c.natural selection

Explanation:

Help me please, I’m confused

Answers

Answer:

Photosynthesis-

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities. Photosynthesis occurs in the chloroplast of a plant, which contains chlorophyll. In order for photosynthesis to take place, it needs to have water and carbon dioxide, the two very important raw materials necessary for this process. In the presence of carbon dioxide, such cells are able to convert this solar energy into energy-rich organic molecules, such as this energy-rich molecule known as glucose. Oxygen the by product of photosynthesis is inhaled by heterotrophs which aids in cellular respiration and other internal processes and then exhales carbon dioxide. ... In like manner, carbon dioxide passes from blood to the alveoli and exhaled after

Explanation:

which word refers to a substance that repels ( or is repelled ) from water
a - hydrophilic
b- hydrophobic
c- hydraulic
d- neo-hydro

Answers

Answer:

B- hydrophobic!

hope this helped you out! i would apreciate brainliest too:)

Explanation:

Can someone help me with this chromosome assignment?

Answers

this is the answer for only first page.

homologous, diploid,gametes,haploid

the same thing as what the other person said.

di=2

hap=1

remember that for diploid and haploid

PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!
How do living organisms maintain homeostasis within their bodies?

Answers

Answer:

The body regulates those levels in an example of homeostasis. When levels decrease, the parathyroid releases hormones. If calcium levels become too high, the thyroid helps out by fixing calcium in the bones and lowering blood calcium levels. The nervous system helps keep homeostasis in breathing patterns.

Explanation:

Hope this helps :)) Please mark brainliest :))

Answer:

Look below.

Explanation:

They maintain homeostasis by regulating temp, glucose, toxins, blood pressure, and pH.

A cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes
a.True
b.False

Answers

Answer:

the answer is true because a cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes

The vocal cords stretch across the opening of the larynx. True or false??

Answers

Answer:

True

Explanation:

Vocal cords are bands of smooth muscle tissue located in the larynx. When air passes through, the vocal cords vibrate.

Answer: True

Explanation:

The vocal folds, also known popularly as vocal cords, are composed of twin infoldings of mucous membrane stretched horizontally across the larynx. They vibrate, modulating the flow of air being expelled from the lungs during phonation.

Which statement best explains why the classification
schemes of taxonomists have changed over time?
A. New technology like DNA sequencing allows scientist to have a more accurate genetic evolutionary history
B. New information about the genetics of species is being discovered.
C. Molecular biology has provided more detailed evidence for the relationships
between organisms.
D. All of the above

Answers

Answer:

D.

Explanation:

Sana tama kase feel ko pang

Classification of organisms is defined as dividing living beings into different kingdoms based on their genetics, traits, and other features.

Why did Classification Schemes of taxonomists change?

Taxonomists arrange and divide the organisms based on the DNA, traits, and features of the living organisms.

The advancements in technology led the taxonomists to have more information on genetic lineage and arrange them accordingly.

Introduction and discoveries of new species, their genetic make-up, and traits also contribute to the change of classification system.

Molecular biology, cellular level studies, and genetics of species have contributed to the classification of organisms.

Thus, the given statements about the classification of organisms are correct.

Learn more about the classification system here:

https://brainly.com/question/9046656

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

Tectonic plates can affect __________________ environmental changes, which might be a cause for species extinction

Answers

Answer:

I believe it is long term.

Explanation:

did it in edge 2020

The sun converts nuclear energy into what type of energy?

Answers

Answer:

i would say chemical but if im wrong im super sorry!!

Explanation:

Consider two individuals that have the following genotypes: CCDd and Ccdd.
Predict the outcomes of a cross for these two individuals. What are the outcomes that could occur in the offspring? Select ALL that
apply.
A)
1/4 of the offspring will be CCdd.
B)
ccdd is not possible as an outcome of this cross,
All of the offspring will show the dominant trait for the allele.
D)
Only half of the offspring will show the dominant trait for the Dallele.
E)
All of the offspring will be heterozygous and will display the dominant
traits

Answers

Answer:

A,B,C,D

Explanation:

Since one parent is CC, there is no way to get cc as an outcome from this cross. However, there is also no way that all of the offspring will be CcDd, which is heterozygous for both traits. Therefore, this is the only answer choice that is incorrect.

As per observation about the  two individuals that have the following genotypes: CCDd and Ccdd the cross are options: a,b,c,d.

Since one parent is CC, there may be no manner to get cc as an final results from this cross. However, there may be additionally no manner that every one of the offspring could be CcDd, that is impure breed for each traits.

What is genotype ?

Genotype is an individual's series of genes. The time period can also talk to the 2 alleles inherited for a specific gene. The genotype is expressed while the statistics encoded within side the genes' DNA is used to make protein and RNA molecules.

Thus it is clear that all the observations are correct.

To learn about genotypes refer to the link ;

https://brainly.com/question/2235939

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

What does the temporal lobe and Cerebellum do?

Answers

Answer:

The temporal lobes are also believed to play an important role in processing affect/emotions, language, and certain aspects of visual perception.

The cerebellum is busy planning, adjusting and executing movements of the body, the limbs and the eyes.

Explanation:

Hello My name Is Chloe, Do you think you can help me with My Question
I need Facts on sharks.
I'm doing a report for school.
Thanks:)

Answers

Answers:

Here are some fact about sharks that i found cool

#1

Possibly one of the most evolved sharks today are hammerhead sharks. They have an advanced sensory system and a body shape that has adapted to hunt specific prey

#2

Sharks may be one of the most important species on Earth. They have been maintaining our oceans for over 400 millions years.

#3

Sharks have evolved and changed much over millions of years. However many sharks today still share some of the features as sharks from millions of years ago.

#4

Sharks have been in our oceans for over 400 million years. Some of the earliest sharks were discovered dating back to the Devonian age.

#5

Sharks have survived five massive planet extinction events. These extinction events killed most life on earth and the last one around 65 million yeas ago killed the dinosaurs.

#6

There are over 500 species of shark.

#7

It is believed that each whale shark's pattern is unique, like a human's fingerprint.

#8

Sharks do not have bones. Instead, they have cartilage, that's what makes up human noses and ears

#9

According to the Smit.hsonian, there are over 500 known shark species, though many are endangered or declining due to various factors like overfishing.

#10

Your odds of getting attacked and killed by a shark are 1 in 3,748,067. In a lifetime, you are more likely to die from fireworks or lightning. Whereas over 100 million sharks are killed every year by humans.

#11

Whale sharks are the world’s biggest fish.

#12

Sharks mature slowly and reach reproductive age anywhere from 12 to 15 years.

#13

Hammerhead sharks' eyes are on the sides of their heads, so they have nearly a 360-degree sight line. Their panoramic view of the undersea world is inhibited by two blind spots, one in front of the snout and the other directly behind the head.

#14

Sharks predate the dinosaurs by 200 million years.

#15

Great whites can detect one drop of blood in 25 gal (100 L) of water and can sense even tiny amounts of blood in the water up to 3 mi (5 km) away.

(sorry if this took a lot of time but i had search somethings)

Have a nice day!

Answer:

Sharks do not have bones. ... Most sharks have good eyesight. ... Sharks have special electroreceptor organs. ... Shark skin feels similar to sandpaper. ... Sharks can go into a trance. ... Sharks have been around a very long time. ... Scientists age sharks by counting the rings on their vertebrae. ... Blue sharks are really blue.Sharks, in some form or another, have been around for 450 million years. ... There are over 500 species of shark. ... Sharks do not have bones. ... The whale shark is the largest fish in the ocean. ... Another shark species is the hammerhead shark, known for its distinct appearance.

Explanation:

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

Virtual Lab
Active
Create a dichotomous key.
O
Magnifying Glass
Drag your question here.
Legs
Wings
Antennae
Stinget
Claws
Please help

Answers

Answer:

WHAT ARE YOU TRYING TO ASK BRO

How do human lifestyles affect sustainability?

Answers

Answer: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.

Fill in the blanks the world banks the word bank is on the picture provided below :)

Answers

Answer:

1 is pioneer species 2 is limiting factor 3 is ecological succession

Explanation:

Answer:

1) pioneer

2) limiting factor

3) ecological succession

What are some factors that can cause observed evolutionary change?

Answers

Answer:

There are four such forces: mutation, gene flow, genetic drift, and natural selection.

Explanation:

Answer:

natural selection, random genetic drift, mutation, population mating structure, and culture.

Explanation:

I hope this helps! ^^

☁️☁️☁️☁️☁️☁️☁️☁️

Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspring. Use your understanding of natural selection to describe how polar bears became a separate classification from the grizzly.

Answers

Scientists believe that at first these bears scavenged seal carcasses that had washed ashore, and gradually began to hunt the seals by waiting at the water's edge as the seals surfaced to breathe. This is believed to be an important step in the evolution of a new bear species, the polar bear

Over time the new polar bears were used to the cold climate and learnt how to fish, they then separated from the grizzly bears, they developed new creatures which would help them survive in one of the most dangerous climate.

Polar bears become separate classification from the grizzly by the natural selection known as divergent and adaptive evolutionary change.

Polar bears and grizzly bears are considered as closed to one another so they can interbreed. They both diverged from one another due to the harsh climate of the Arctic and the ecology of the region.

The changes that took place are camouflaging and pigment-free fur-coat that helped them in order to adapt to the different climates.The genetic mutation leads to such Adaptive changes when the polar bears migrated northwards.The populations living in different climates undergo natural selection that is divergent natural selection and the adaptive evolutionary changes that result in different species.

Learn more about speciation:

https://brainly.com/question/4493180

help me out girlies its due

Answers

the stereotype is that all australians are some sort of zookeepers? and wear clothes like that. also that they drink beer a lot.

Answer:

the stereotype is that all australians are zookeepers? and wear clothes like that.

Explanation:

why are there 2 hydrogen atoms and only one oxygen

Answers

Answer:

Oxygen is an electronegative

Explanation:

Not only is it because in the chemical equation for water there is 2 hydrogen atoms and 1 oxygen atom, but they also share their electrons to fill their outermost levels and that are attracted together.

Hope this helps!!

A liquid is matter that
A. has a definite volume and takes the shape of its
container.
B. has a definite shape and won't take the shape of its
container.
C. has no shape, and its volume changes randomly.
D. has a volume that changes with its container.

Answers

Answer:

272939

Explanation:

373773737384848

Answer is D =). Ur welcome sowwy if I’m wring

NEED HELP ITS DUE AFTER MY WINTER BREAK!

Answers

Answer:

For question 1 the answer is respiratory, and for question 2 is circulatory

Answer: (1) Circulatory (2) Respiratory

Other Questions
HElp please thanks Ill give Brainly 9 or 8 points i think*** please help ^^ 1. Which statement best identifies the poet's purpose inthe poem?O A to test children on how much they know about PaulRevere's famous rideOB to share the story of how Paul Revere alerted peopleto the approaching British ArmyOC to share the story of how an innkeeper helped PaulRevere stop an approaching British ArmyOD to suggest that it was Paul Revere's friends whoalerted people of the approaching British Army, notRevereSAVE & NEXT Which word has a spelling error?OA. misnomerOB. pnewmaticOC. pulverizeOD. distraught There are more than one answer help me and I give brainilest Solve the system below"Wy = - 3x + 17y = -x + 3O (7.4)O (-7,-4)O (7.-4) Rhian sat a maths test and an English test. in the maths test, she scored 14/17. in the English test, she scored 31/39. in which test did she do better Offline, create a complete pictogram that represents (1) the various sources of energy; (2) the percentage of global consumption for each as shown in the video; and (3) what each source is used for (electricity, transportation, heat). Use the illustration from the video as a guide. Genomic imprinting may involve a single gene, a part of a chromosome, or a whole chromosome. Indicate if the following statements are true or false regarding this phenomenon 1. Genomic imprinting is permanent in the somatic cells of a given individual. _____________2. Genomic imprinting is permanent and affects future generations. ____________3. Methylation is the chemical change underlying genomic imprinting. _____________4. If a gene is imprinted, the offspring can express both the maternal and paternal allele. _________ A rectangle is such that the length of 2 of each adjacent sides are in the ratio 1:3. A similar rectangle has 1 side of 6cm. Find 2 possible values for the length of each adjacent sides. What is BC in simplest radical form Jill collected honey from 9 different beehives, and recorded the amount collected, in gallons, from each hive in the line plot shown: She wants to write the value of each point marked on the number line above (Points A-D) in gallons. What is the value of A using fractions? My brother needs help I don't remember this devilish stuff Read the excerpt from act 3 of A Doll's House.Krogstad: If it were as you say, why did you write to meas you did at the time?Mrs. Linde: I could do nothing else. As I had to breakwith you, it was my duty also to put an end to all thatyou felt for me.Krogstad (wringing his hands]. So that was it. And allthis only for the sake of money!Mrs. Linde: You must not forget that I had a helplessmother and two little brothers. We couldn't wait for you,Nils: your prospects seemed hopeless then.Which theme is best developed through the eventsdescribed in this passage?O Ending a relationship will help those involved moveforward.O True love always prevails regardless of thecircumstances.O Pleasing one's family will eventually lead to pleasingoneself.O Monetary concerns can sometimes outweighpersonal desires. What was the purpose of the Land Ordinance of 1785? A) To outline how the Great Lakes would be divided between the United States and Britain B) To explain how the original 13 states would be divided after the war C) To outline policies for dividing the land north of the Ohio River D) To explain how new states could be formed from territories Which equation shows the same relationship as 4 = 1/5 x 20choose 1 answer:A. 4 20 = 1/5B. 20 = 1/5 4C. 20 x 4 = 1/5 Because they were not allowed to trade freely, manly of the colonists were ______ goods from the colonies to make more money Familia lexica de Describir y correr Five Saturnians are shown below. Bruce is frowning and has the same antennae as Eve. Abby and Cindy are both smiling but only one has three eyes. Dave, Eve, and Cindy all have the same number of eyes. Eve is pictured directly to the left of Dave. Which Saturnian is smiling and has curved antennae. The equation y=0.24x+1.20 can be used to predict the price of fuel oil per gallon,where x is the number of years since 2002. According to the model, what will be theprice of fuel oil per gallon be in 2018? why does thunder snow happen