need help with this question, please

Need Help With This Question, Please

Answers

Answer 1

Given:

The expression is:

[tex]\left(\dfrac{6}{17}t-6\right)+\left(\dfrac{7}{17}t+9\right)[/tex]

To find:

The missing values in the simplification of the given expression.

Solution:

We have,

[tex]\left(\dfrac{6}{17}t-6\right)+\left(\dfrac{7}{17}t+9\right)[/tex]

Combining like terms, we get

[tex]\left(\dfrac{6}{17}t-6\right)+\left(\dfrac{7}{17}t+9\right)=\left(\dfrac{6}{17}t+\dfrac{7}{17}t\right)+\left(-6+9\right)[/tex]

[tex]\left(\dfrac{6}{17}t-6\right)+\left(\dfrac{7}{17}t+9\right)=\dfrac{13}{17}t+3[/tex]

Therefore, the missing values for 1,2,3,4 blanks are [tex]\dfrac{6}{17}t,9,\dfrac{13}{17},3[/tex] respectively.


Related Questions

A net has a square at the center and 4 triangles on the sides. The square has side lengths of 2 feet. The triangles have a base of 2 feet and a height of 5 feet.
Rahul is wrapping a gift that has the dimensions shown. What is the least amount of wrapping paper he will need?

ft2

Answers

Answer:

24 ft.2

Step-by-step explanation:

correct on edge 2021 instruction

have a good day <3

Answer:

24 is the answer

Step-by-step explanation:

Circumference (Level 2)

Answers

Answer:

The diameter is 13

Step-by-step explanation:

Circumference can be found by diameter*π

In this case its 13π sooooooooo the diater is obvious. It’s 13 meters

Answer:

radius r = 2.06901426 m

diameter d = 4.13802852 m

circumference C = 13 m

area A = 13.4485927 m2

choose yes or no to tell if the fraction 2/9 will make each equation true
81 x =18
900 x = 200
72 x =16
450x = 100

Answers

Answer:

yes

Step-by-step explanation:

to see if 2/9 will make each equation true, you replace 'x' with 2/9, so let us do just that-

81*2/9=18

900*2/9=200

72*2/9=16

72*2/9=16

450*2/9=100

now, seeing as how every answer we've gotten matches the answers of the algebraic equations, the answer is yes 2/9 does make each equation true

good luck :)

i hope this helps

brainliest would be highly appreciated

have a nice day!

Answer:

Step-by-step explanation:

Please help

A sign on the road says: “Speed limit, 60 mph.” Let s be the speed of a car. Write an inequality that matches the information on the sign. *
(I copied and pasted)

Answers

Answer:

60 in the inequality

Step-by-step explanation:

The formula for finding the volume of a rectangular prism is V = Bh. A rectangular prism with dimensions _________ will have a volume of 150 cubic units.

Answers

Answer: 10 * 5 * 3

Step-by-step explanation:

We want to find a base and a height that will multiply together to equal 150 [tex]units^{3}[/tex].

One solution is a [tex]B = 50 units^{3}[/tex] and [tex]h = 3 units^{3}[/tex].

Thus we need a length and width of the base that will multiply together to equal 50 [tex]units^{2}[/tex]. One solution is 10 units * 5 units.

Putting this all together, we have a solution of 10 units * 5 units * 3 units, which will have volume of 150 cubic units.

a b and c are different questions
Rachel found that the time it takes for her to make her favorite desert decreases the more times she makes its. The time is takes in minutes(M) can be modeled by: M=72-0.75n, where n is the number of times that rachel has made the desert.
A. how long will it take rachel to make her desert the fifth time?

B. after how many times will rachel be able to make her desert in 63 minutes?

C. How long will it take rachel to make her desert the 40th time? Do you think this is reasonable?

Answers

5, 12, & 42 are your answers

What's the surface area?

(EXPLAIN YOUR ANSWER)

Answers

714,110ft



Hope this helpsss

Josie selected 6 books from the library. However, he can only check out 4 books at a time. How many possible selections can he make?

Answers

Answer:  only 4 boi

Step-by-step explanation:

What is the greatest common factor of 50, 25 and 100

Answers

Answer:

The common factors for 50,25,100 50 , 25 , 100 are −25,−5,−1,1,5,25 - 25 , - 5 , - 1 , 1 , 5 , 25

complete this correctly and I will give you brainliest
For the three-part question that follows, provide your answer to each question in the given workspace. Identify each part with a coordinating response. Be sure to clearly label each part of your response as Part A, Part B, and Part C.
Part A: A homeowner wants to purchase new carpet for his rectangular living room, which is 8 feet wide and 12 feet long. What is the area of the carpet needed to completely cover the floor of the living room? Choose the correct answer.

A. 40 feet

B. 40 square feet

C. 96 square feet

D. 96 feet


Part B: Bianca wants to wrap a gift for her sister. The gift is in a box with a length of 10 inches, height of 2 inches, and depth of 3 inches. What is the minimum amount of wrapping paper Bianca needs to completely cover the box?

Part C: Greg had a rectangular vegetable garden that was 4 feet wide by 5 feet long. He increased the length of his garden by 2 feet and doubled the width. How many square feet larger is the area of his new garden compared to the area of his old garden? In a short paragraph, explain your answer in your own words.

Answers

part a: c. 96 square feet

part b: 60 inches

part c: 36 square feet


explanation: I multiplied 4 and 5 because area = l•w meaning the garden was originally 20 square feet. I then doubled the making it 8 and added two feet to the length making it 7 feet. Since area equals l•w i multiplied 8 and 7 getting 56 square feet. Since the question asked, “how many square feet larger,” I subtracted the new area, 56 square feet, by the old one, 20 square feet, and got 36 square feet.

CORRECT ANSWERS WILL GET BRAINLIEST. 26 POINTS.

Compare the parallel boxplots. Which statement must be true? A) male plot has a smaller median and is not skewed B) male plot has a larger median and is skewed left C) male plot has a larger median and is skewed right D) female plot has a larger median and is skewed left

Answers

Answer:

A

Step by step explanation

b) male has larger median and is skewed left
due to the fact that the box plot is uneven and more space to the left then it’s skewed to left. and it has larger median than female

I need help lol... find the value of x

Answers

Answer:

B. x=37

Step-by-step explanation:

These are vertical opposite angles and they are equal to each other.

so, 2x+6=80

2x=74

x=37

37 bestie so true...

Find the measure of 1

Answers

Answer:

It should be 64 as well.

Step-by-step explanation:

A square pyramid is shown sitting on its base.

12 cm
12 cm
8 cm

The surface area of the pyramid is square centimeters.

Answers

Answer:

It is a square

Step-by-step explanation:

that it it the first is the top the secened is the bottem and the last iis the sides

help me plz which one of the four

Answers

Answer: 56 square feet

Step-by-step explanation:

1. Split into two separate squares

2. Find area of both squares (based x height)

3. Add areas together

It’s 56 square feet luv :)

Someone help, I can't figure this out lol

Answers

Answer: (13) 128 (14) 3 (15) 38 (16) 21

Step-by-step explanation:

13) (x+3)+49=180

14) 66+8x=90

15) (x+3)+49=90

16) 3x+117=180

Yeah uh...Just answer the question and don't judge me pls!

Answers

Answer:

It is true that about 1/4 of the world production of tin comes from Indonesia.

Step-by-step explanation:

Hi, I also just wanted to answer so that you may provide your friend with brainliest! Good luck!

Hope this helps! :)

This is not so hard please helpp

Answers

Answer:

23. 3

24. 9

25. 22

26. 2

Step-by-step explanation:

Answer:

23. 3

24. 9

25. 22

26. 100 I think

Step-by-step explanation:

23. 15 x 1/5 = 3

24. 45 x 1/5 = 9

25. 7 x 2 = 14 + 8 =22

26. 50 x 1/5 = 10, 10^2 = 100

WILL GIVE BRAINLIEST Write a function that represents the arithmetic sequence shown in the mapping diagram.

Answers

Answer is 6n + 17
When you plug in 1, 4, 12 for n then do the math you get the 23, 41, and 89.

The sum of the squares of three consecutive integer numbers is 1454. Find the numbers. I have already found 21 22 23 but the question says that there are 2 possibilities. please help!!!!!!

Answers

Answer:

three consecutive integers

Let x,(x+1),(x+2) represent the three consecutive integers

Question states

x^2 +(x+1)^2+(x+2)^2 = 110

Solving for x

3x^2 + 6x  + 5 = 110

3x^2 + 6x  -105 = 0

3(x^2 + 2x - 35)  = 0

 (x^2 + 2x - 35)  = 0  

factoring

 (x+7)(x-5) = 0 Note: SUM of the inner product(7x) and the outer product(-5x) = 2x

 (x+7)=0  |x = -7  The three consecutive integers are -5,-6,-7

 (x-5)=0  |x = 5   The three consecutive integers are 5,6,7

25 + 36 + 49 = 110  

The three consecutive integer numbers are 21, 22 and 23

Let the 3consecutive integers be x-1, x and x+1

Taking the sum of the squares

(x-1)²+x² + (x+1)² = 1454

x²-2x+1+x²+x²+2x+1 = 1454

3x²+2 = 1454

3x²= 1452

x² = 484

x = 22

First number is x - 1 = 22 - 1 = 21

second number is x = 22

Third number is x+ 1= 22+ 1 = 23

Hence the three consecutive integer numbers are 21, 22 and 23

Learn more here: https://brainly.com/question/24272171

Hi, pls answer asap I will give briniest and 5 points!!
the first two are example's!

Answers

Step-by-step explanation:

lo siento no puedo ablar ingles si pusieras a español te respondo

Answer:

10. 8 1/10

11. 5 1/4

12. 7 1/8

13. 4

14.  5 3/10

15. 4 1/3

16. 8 3/8

middle school mathematics....

Answers

Answer:

Step-by-step explanation:

Im sure your done with this and don't need anyone to answer this anymore

ASAP ONE MORE BRAINLIEST

Answers

Answer:

A) 1/6

Step-by-step explanation:

[tex]A=\frac{16\frac{2}{3} }{100}[/tex]

[tex]A=0.1666666....[/tex]

[tex]A=\frac{1}{6}[/tex]

Answer:

a

Step-by-step explanation:

How many more grams of fat does the median ice cream serving have than the median chocolate serving?

Answers

Answer:

about 2 grams

Step-by-step explanation:

i looked at the line thingy

answer: about 2 grams
hope this helps you out .

A cube-shaped box can be made from 486 square inches of cardboard. What is the volume of the box?

Answers

Answer:

1944

Step-by-step explanation:

The volume of the box is,

⇒ V = 729 inch³

What is Division method?

Division method is used to distributing a group of things into equal parts. Division is just opposite of multiplications.

For example, dividing 20 by 2 means splitting 20 into 2 equal groups of 10.

We have to given that;

A cube-shaped box can be made from 486 square inches of cardboard.

Now, We know that;

The surface of a cube is given by the expression,

⇒ S = 6L²

Where, L is the length of the edge of the cube.

Hence, We can formulate;

⇒ S = 6L²

⇒ 486 = 6L²

⇒ L² = 81

⇒ L = 9 inch

Thus, The volume of the box is,

V = L³

V = 9³

V = 729 inch³

Learn more about the divide visit:

https://brainly.com/question/28119824

#SPJ3

The scatter plot below shows a plant’s height over time. Based on the graph, what is the best prediction for the plant’s height after 10 weeks?
A. 5 inches
B. 5.8 inches
C. 6 inches
D. 7.1 inches

Answers

you’re answer is D. your plants height increases by about .5 inches every other week

What were the dimensions of the slice defined as RSTU in Exercise 1?
Question 2 options:


10 cm by 18 cm


18 cm by 18 cm


11 cm by 18 cm


11 cm by 10 cm

Answers

Answer:

how can I tell u the answer which out a pic

Step-by-step explanation:

The scatter plot shows the temperature and the number of frozen yogurt bars sold during 10 baseball games. Using the trend in the scatter plot, approximately how many yogurt bars can the home team plan to sell when the temperature reaches 80°F?

Answers

60? Is what I think

please help me asap PLEASEEEEEEEE I CANT DO THIS

Answers

Answer:

1. Yes

2. Exactly Double

Hope this helps and have a great day :)

Step-by-step explanation:

I agree with the person before me
1. Yes
2. Exactly double

pleasee help! Use the Transversal drawing that I created and find the value of x and the value of all the other angles

Answers

Answer:

dont understand this ...

Step-by-step explanation:

x is 52? this makes no sense lol wgat
Other Questions
16 cars are parked if 1/4 of them are blue how many cars are blue What is the moral of the story of the chapter/essay 'Primary Lessons' in Silent Dancing by Judith Ortiz sketch the electrolytic cell for converting alumina to aluminum A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include Which expressions simplify to 4? Select all that apply. Help meeeeeeeeB) Write the name of the food that does not belong to the same category and explain why.Ex. tarta- helado-pimienta-manzana. La pimienta. No es dulce.1. refresco/agua/leche/carne/. _______________________. _________________________2. banana/manzana/pescado/naranja/.________________. ________________________3. fruta/helado/torta/pescado/. ________________________. ________________________4. pollo/ pescado/carne/refresco/. _______________________. ______________________5. pastel/ leche/ jugo de naranja/t/______________________. _______________________ How many molecules of methane gas (CH4) are in 32.1 grams of methane i need help with that please . Why does a mountain create a rain shadow on the other side of a mountain? Calculate the volume of a cuboid with length 5.6m breadth 4.1m, height 3.4m What is the mean of the set of data? 18, 11, 16, 8, 16, 21 plz help If you were a jedi during order 66 were would you hide? Help plz due now will mark brainliest if correct Why does dally like to fight Use variables to write an equation that represents the relationship between the time x and the distance y . A person runs 175 yards per minute.An equation that represents the relationship is y=______ PLEASE HELP ILL MARK BRAINLIEST Which of these statements is NOT true about African Americans beforethe Civil War? *A. Free Blacks in the North enjoyed many freedoms but not equalityB. Very few African-Americans in the South were free.C. Most African-Americans in the North were free.D. Most African-Americans in the South were free. HELP!!! Name the space figure you can form from the net. Three Methods for Choosing JudgesAt the federal level, judges are nominated by the President and then those nominees have to be approved by the Senate. The U.S. Constitution does not specify how states can choose their judges so different states use different methods. The three most common methods used by states are listed below:Method 1: Direct elections - Candidates raise money and campaign to be a judge. The voters then elect one of the candidates.Method 2: Appointment - In this method, state judges are appointed by the Governor. There is often no legislative approval required. A couple of states have the state legislature appoint judges, but usually it is the Governor.Method 3: The Missouri Plan - This is a compromise between methods 1 and 2. In the Missouri Plan, the governor appoints judges, but the governor must make each appointment from a list of three candidates recommended by a judicial nominating commission. The commission is made up of a sitting judge, several legal experts, and some private citizens. Each judge named by the governor serves until the next election. The judge's name then appears on the ballot without opposition. The voters decide, in a yes-no vote, whether or not that judge should be kept in office. Should the voters reject a sitting judge, the process begins again.Read the information above about the three methods most commonly used to select judges at the state level. Pick the method that you believe is the best. Write a paragraph persuading your fellow Ohioans that Ohio should start using this method. If you agree with how Ohio already chooses its judges, then persuade a different state to use our current method. Your essay needs to provide three (3) arguments supporting your method of choice, and you need to back these arguments up with supporting details. For example, you could use constitutional principles to back up your arguments.plz help Ultraviolet light from the Sun can Hi here equation everybody please help thanks Steam Workshop Downloader