The most common explanation of the transmission of the Black Death is flea bites. Infected fleas were carried on rodents, and these fleas transmitted the virus to humans.
There are still several different theories about how the Black Death was spread, however. There's a Wiki page called "Theories of the Black Death" that may be helpful.
At the time of the Black Death, bacteria and viruses hadn't been discovered yet. People thought that sickness was transferred through bad smells, which were called "miasma."
The long beaks of the masks were stuffed with strong-smelling herbs, spices, and dried flowers—lavender, roses, peppermint—which were thought to keep away the "evil" smells that were thought to cause disease.
Pretty cool stuff!
Any one free
InboX me (◍•ᴗ•◍)❤
Answer:
hiii
Explanation:
What is Pedigree?? Can someone help me i need this answer plzzzzzz
Answer:
A pedigree is like a lineage or a recorded ancestry. For example, if a dog has recorded breeding papers it would show you it's pedigree. I hope that helped! :)
Do all plants respond the same to all abiotic factors?
Answer:
Light intensity: limited light will limit photosynthesis. This will affect the distribution of plants, and therefore the distribution of animals that eat plants. ... Temperature: temperature is a limiting factor for photosynthesis - and low temperature therefore limits growth of plants.
Which antivenom will save Tyler?
Select one:
a.
Antivenom A
b.
Antivenom B
c.
Antivenom C
d.
Antivenom D
Answer:
b
Explanation:
Michael loves playing his clarinet and believes it attracts more rabbits than any other instrument he
has played. In order to test his hypothesis, Michael played a song on his clarinet for a total of 5
minutes and counted the number of rabbits he saw in his front yard. He played the song a total of 3
times on his clarinet and repeated the experiment using a flute and a guitar. He also recorded the
number of rabbits he observed when he was not playing an instrument. The results are shown in the
chart.
Number of Rabbits
TRIAL
NO MUSIC
CLARINET
FLUTE
GUITAR
15
1
2
3
5
3
2
10
12
5
8
9
12
18
7
1) What is the independent variable?
2) What is the dependent variable?
3) What is the experimental group?
4) What is the control group?
5) What is one constant from the experiment above??
Answer:
Independent variable: type of instrument
Dependent variable: Number of rabbits attracted
Experimental group: The group when he played an instrument
Control group: The group when not playing an instrument
Constant: Same song
Explanation:
1. Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the variable that is changed is the TYPE OF INSTRUMENT used (clarinet, flute, guitar), hence, it is the independent variable.
2. Dependent variable is the variable that is measured in an experiment. It is the variable that responds to the changes made to the independent variable. In this experiment, the dependent variable is the "NUMBER OF RABBITS ATTRACTED" by the instrument played.
3. Experimental group is the group of an experiment that receives experiment treatment, which is the independent variable. In this case, the experimental group is the GROUP IN WHICH INSTRUMENT WAS PLAYED.
4. Control group is the group that does not receive the experimental treatment. In this case, the control group is the group in which INSTRUMENT WAS NOT PLAYED.
5. Constants are those variables that remains unchanged for all groups throughout the experiment. In this case, one constant is the SAME SONG played.
Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil
Answer:
B)Magma
Explanation:
Combined sewage overflow has been linked to eutrophication in ecosystems within NYC, including Jamaica Bay and Coney Island Creek. Based on your understanding of eutrophication, why might combined sewage overflow be causing an overgrowth of harmful algae in NYC? Explain your answer in YOUR OWN WORDS please.
(This is 7th grade science).
like your name
Explanation:
The chemical equation for cellular respiration is:
glucose + oxygen ----> your mama
carbon dioxide + water
sunlight --->glucose + oxygen
oxygen + carbon dioxide glucose + water
glucose + oxygen --->carbon dioxide + water + ATP (energy)
Answer: The last one
Explanation:
Glucose+oxygen----> Carbon dioxide+ water+ ATP(energy)
Name the features caused by wave erosion and label them in the order that they would
occur. Write a short description of each feature.
Hint. There are 6 features.
Caves
Sea cliffs, sea stacks, sea caves, sea arches, handlands, and wave-cut terraces.
one is missing but u can just check it on quizlet
You want to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%). How much of each will he have to mix together? Show your work for full credit.
Answer:
To make a 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%), 0.6 tons of soybean meal and 0.4 tons of corn are needed
Explanation:
Using the Pearson’s Square calculations:
1. Subtract across the diagonal:
a. 18% - 12% = 6 parts soybean meal
b. 18% - 22% = 4 parts corn
2. Sum the parts:
a. 6 parts soybean meal + 4 parts corn = 10 totalparts
3. Divide each part by the total to calculate the percentage of each feed to include in the ration:
a. 6 parts soybean meal ÷ 10 total parts * 100 = 60.0% soybean meal
b. 4 parts corn ÷ 10 total parts * 100 = 40.0% corn
So, to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%),
60% of soybean meal is needed = 60/100 * 1 ton = 0.6 tons of soybean meal
40% of corn is needed = 40/100 * 1 ton = 0.4 tons of corn
although farmers once used only organic fertilizers to replenish nutrients in the soils, some have been replaced with synthetic fertilizers. Although synthetic fertilizers keep nutrient levels high and increase crop yields, they can have an effect on the environment. Which of the following would most likely lead to a ban of synthetic fertilizers?
A. Synthetic fertilizers help prevent the spread of diseases.
B. Synthetic fertilizers are less expensive than organic fertilizers.
C. Synthetic fertilizers increase the potential for environmental pollution.
D. Synthetic fertilizers provide nutrients, like nitrogen that can disrupt nutrient cycling.
Answer: C. Synthetic fertilizers increase the potential for environmental pollution.
Explanation:
A fertilizer is a material which when applied to soil ,supply one or more plant nutrients essential to the growth of plants.
Fertilizers could be organic ( obtained from nature ) or could be synthetic ( made artificially in labs).
Though synthetic fertilizers such as urea keep nutrient levels high and increase crop yields but they also kill beneficial microorganisms in the soil that convert dead human and plant remains into nutrient-rich organic matter. The non biodegardable synthetic fertilizers seep into groundwater and increase its toxicity, causing water pollution.
Synthetic fertilizers damage the natural makeup of the soil. Plants that grow in soils which use synthetic fertilizers are deficient in iron, zinc, carotene, vitamin C, copper and protein.
Fill in the blank: ______ is the process that splits rock when water seeps into cracks, then freezes and expands.
YES I WILL HAVE A LOT OF FILL IN THE BLANK GET READY
Answer:
Freeze-thaw
Explanation:
Answer:
frost wedging
Explanation:
Plz help me its only 1 question
Answer:
the first one
Explanation:
the car slowly started and accelerated
Its the second one. Since its continually accelerating.
Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.
Answer:
a. The ability to cure genetic diseases by replacing defective genes
Explanation:
what is the meaning of biosphere
Answer:
The biosphere is a global ecosystem composed of living organisms (biota) and the abiotic (nonliving) factors from which they derive energy and nutrients. Earth's environmental spheres. Earth's environment includes the atmosphere, the hydrosphere, the lithosphere, and the biosphere.
Explanation:
''.''
Would you expect the stomata of a desert cactus or the stomata of a water lily plant to close during the day?
The stomata of a desert cactus will close during the day.
STOMATA:
The stomata (singular- stoma) are structures on the leaves of a plant that helps in gaseous exchange i.e. entry and exit of CO2 and O2 gases. The stomata, however, when opened allows the passage of water vapor from the plant. Hence, plants utilize the opening and closing of stomata to regulate water loss. Desert cactus is a xerophytic plant meaning that they can survive in low water conditions. One way they adapt to their desert environment, which is characterized by low humidity, is by the closure of their stomata during the day. Therefore, the stomata of a desert cactus will close during the day.Learn more at: https://brainly.com/question/3387375?referrer=searchResults
In an earthworm is the dorsal blood vessel or the ventral blood vessel larger?
Answer:
Dorsal lol, its contracts and pumps blood to the aortic arches.
January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?
Which of the following are sources of extra nutrients that can cause algae to overgrow in water due to HUMAN activity? CAREFULLY select all options that apply. List the answers.
dissolved oxygen in water
treated waste water
viruses
combined sewage overflow (CSO)
fertilizers
cleaning products
dog poop on the streets of NYC
water running over rocks
(This is 7th grade science)
what do eukaryotic cells and viruses have in common?
Answer:
Just search it up
Explanation:
Hello There!
What do viruses have in common with eukaryotic cells?
-Viruses are not cells, but they do have certain things in common.
Viruses & Eukaryotic cells :-
1.Contain DNA, but not much.
2.Can not reproduce by themselves.
3.Have important features such as nucleic acid gnomes.
4.Have genetic variations and can certainly evolve.
Hope This Helps!
Thank you!!! Good Day! ♡
how does Pteromyzon differ from scolidon and labeo fishes?
who answer this question in 10 seconds I'll mark his or her ans. as "BRAINLIST ANSWER"
It's my promise but the answer must not be copied from internet
Answer:
Due to no jaws, no paired fins and scales on the body.
Explanation:
Pteromyzon fish is different from scolidon and labeo fishes because Pteromyzon fish is not a true fish. The main reason for this is that Pteromyzon fish is agnathous means having no jaws and it doesn't have paired fins and scales on their body while all these features are present on the body of scolidon and labeo fishes so we can conclude from this discussion that Pteromyzon fish is different from scolidon and labeo fishes.
Given the following DNA strand TACGTATGCCGTATGGGCATT
a) What is the DNA compliment to given strand?
b) What is the mRNA compliment to the given strand?
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
Which of the following below, best describes a cell from bacteria?
A. A multicellular organism
B. A cell with many organelles
C. Multicellular, Eukaryote
D. Unicellular, prokaryote
Which is an advantage of genetic engineering?
A lack of labeling of food products that have been genetically engineered
B diminished opportunities for organic agriculture
C lack of long-term studies on food safety and environmental impact
D diminished effects of diseases on crops
Answer:
The answer is D.) Diminished effects of diseases on crops.
Explanation: I just took the quiz on edge 2021 :)
An advantage of genetic engineering is the diminished effects of diseases on crops. The correct option is D.
What is genetic engineering?Genetic engineering, often known as genetic modification or genetic manipulation, is the use of biotechnology to directly manipulate an organism's DNA.
The manipulation or modification of an organism's DNA or cells is known as genetic engineering. Cloning is an excellent illustration of genetic engineering in action.
The main worries concerning the negative consequences of GM foods on health include the transmission of antibiotic resistance, toxicity, and allergenic. From the standpoint of allergies, there are two difficulties.
Therefore, the correct option is D, diminished effects of diseases on crops.
To learn more about genetic engineering, refer to the link:
https://brainly.com/question/13491558
#SPJ5
The energy related to the motion of an object is called ___.
Answer:
The answer is kinetic energy
Explanation:
I’m not sure if anyone knows this or not, can someone try and help me with this question!
Answer:
it gives them a mental picture of where they need to plant and pick the cotton
Explanation:
Hope this helps
what is the difference between climate and wheather
Answer:
Weather reflects short-term conditions of the atmosphere while climate is the average daily weather for an extended period of time at a certain location.
:P
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
23. Which of the below names is not a type of biologist?
a) paleontologist
b) botanist
I
c) zoologist
d) astrophysicist
BA
Answer:
D
explanation: it literally has physics in its name
Arrange the levels of ecological organizations from smallest to largest
population
organism
community
ecosystem