In operant conditioning, reinforcement is ____.
a. any food that the organism likes
b. a stimulus that produces a reflexive response
c. an event that decreases the future probability of a response
d. an event that increases the future probability of a response

Answers

Answer 1

In operant conditioning, reinforcement is an event that increases the future probability of a response (Option d).

What is reinforcement in operant conditioning responses?

Reinforcement in operant conditioning responses can be defined as any type of behavior and or action that increase a particular consequence such as occurs in the case of a punishment that reinforces the concomitant negative response in future situations.

Therefore, with this data, we can see that reinforcement in any type of operant conditioning response is a situation that increases the chances of having a particular consequence associated with such action.

Learn more about reinforcement in operant conditioning responses here: https://brainly.com/question/4350686

#SPJ1


Related Questions

what does the combination of the hot, dry summers and abundance of dry vegetation do to the chaparral ecosystems? prone to fires

Answers

Dense evergreen bushes, moderate, moist winters, and scorching, dry summers define the chaparral habitat.

Which statement is not true for the climate of the so. cal. chaparral? The chaparral, sometimes referred to as shrubland, is made up of a number of dense thickets of little trees and drought-tolerant, evergreen sclerophyll plants. Chaparral is a type of woodland with dry soil, warm temperatures, and short, resilient bushes. The chaparral biome is dominated by small woody plants as opposed to tall trees or grasses. Chaparral is only found on the Pacific coast of North America. In sections of California and northern Mexico, where the climate is similar to that of the Mediterranean region with hot, dry summers and warm, wet winters, the majority of the chaparral can be found.A geographical feature known as "chaparral" that is mostly found in the U.S. state of California, southern Oregon, and the northern region of Mexico's Baja California Peninsula is a shrubland plant community. Its Mediterranean environment, which features hot, dry summers and warm, wet winters, as well as infrequent, intense crown fires, shape the region. In contrast to the adjacent soft-leaved, drought-deciduous scrub community of coastal sage scrub, which is frequently found on drier, southern-facing slopes within the chaparral biome, summer-drought-tolerant species are present in chaparral.

Learn more about chaparral refer to:

brainly.com/question/6031886

#SPJ4

The _______ are white, membranous folds attached by muscle to the thyroid and arytenoid cartilages of the larynx on their outer edges. The inner edges are free, allowing oscillation to produce sound.
true vocal folds

Answers

The muscles that make up the vocal folds' actual body are known as thyroarytenoid. By dragging the vocal folds' arytenoid (back) end toward their thyroid (front) end, they shorten the vocal folds.

What is the purpose of the thyroarytenoid muscle?

The muscles that make up the vocal folds' actual body are known as thyroarytenoid. By dragging the vocal folds' arytenoid (back) end toward the thyroid (front) end, they shorten the vocal folds.

Who or what names the vocal folds?

Vocal folds (also known as vocal cords) are extraordinary organs that act as an airway valve and vibrate to produce voice. The vocal folds are multilayer organs made up of a muscle and a mucosal layer. The area between both the two vocal folds is known as the glottis.

To know more about arytenoid muscle visit;

https://brainly.com/question/6672955?

#SPJ4

What must happen to a newly made polypeptide before it can be secreted from a cell?.

Answers

A newly synthesized polypeptide's signal sequence must direct it to the ER, from which it travels to the Golgi, in order for the cell to secrete it.

The creation of a fresh polypeptide is the consequence of which process?

A messenger RNA molecule is produced during transcription utilizing DNA as a template. After the mRNA molecule leaves the nucleus, the translation process starts at a ribosome in the cytoplasm to create a polypeptide.

What transpires when a polypeptide is put together?

The cell builds proteins during translation by using an mRNA strand that it recently transcribed from its genetic code as a template. This just got transcribed by the cell.

To know more about polypeptide's visit:-

https://brainly.com/question/28270191

#SPJ4

compare the changes in blood ph, carbon dioxide, and oxygen during sustained exercise. what causes the large increase in respiratory minute volume during exercise

Answers

Exercise-induced changes in acid-base and ion balance in normoxic and normobaric hypoxia

Complex alterations in acid-base balance are brought on by both exercise and hypoxia. The current study's goal was to determine if the modified physicochemical approach provides a better understanding of the changes in acid-base homeostasis after vigorous physical activity in normoxic and hypoxia than the conventional Henderson-Hasselbalch technique.

Methods

In this prospective, randomized, crossover trial, 19 healthy males underwent two study days of normoxia (12%) and normobaric hypoxia (12% oxygen, equivalent to an altitude of 4500 m) and exercised on a bicycle ergometer until voluntary exhaustion. Following the exercise test, arterial blood gases were sampled and analysed using the modified physicochemical approach and Henderson-Hasselbalch approach, respectively.

learn more about normoxic  using this link:

https://brainly.com/question/14121653

#SPJ4

Plants can reproduce both sexually and asexually. What are some examples of sexual reproduction in plants? select all that apply.

Answers

The genetic material  needed for sexual reproduction must come from both parents. The gametes, or sex cells, of the parent plants are both male and female.

What is Reproduction ?

To create babies, the genetic material from the male and female gametes is combined. This procedure is known as fertilization. Seeds are the result of sexual reproduction.

Genetic material from both parents is present in seeds that are created by fertilization. As a result, neither of the parent plants' offspring and the offspring are genetically similar. They may be able to survive if the environment changes thanks to their genetic variety.

Pollination, the act of sexual reproduction in flowering plants, is how it happens. Stamens, the male sex organ, and pistils, the female sex organ, are found in flowers.

Therefore, The genetic material  needed for sexual reproduction must come from both parents. The gametes, or sex cells, of the parent plants are both male and female.

To learn more about pollination, refer to the link:

https://brainly.com/question/28301188

#SPJ1

fatigue caused by depletion of glycogen stores and declining blood glucose during exercise is sometimes called

Answers

Answer:

Neuroglucopenia is the right answer

Explanation:

Test 2022

A glomerulus is:
A) the source of erythropoietin.
B) attached to the collecting duct.
C) a hairpin loop segment of the renal tubule.
D) a set of capillaries within the renal corpuscle.

Answers

A glomerulus is the set of capillaries within the renal corpuscle (option D).

What is the glomerulus?

Glomerulus is a small intertwined group of capillaries within nephrons of the kidney that filter the blood to make urine.

The kidneys (major excretory organ) remove excess fluid and waste from the body. Blood is filtered in the kidneys through nephrons.

Each nephron contains a network of small blood vessels, called glomerulus, which are enclosed in a sac called Bowman's capsule.

The thin walls of the glomerulus allow smaller molecules, wastes, and fluid (mostly water) to pass into the tubule while larger molecules, such as proteins and blood cells, stay in the blood vessel.

Therefore, glomerulus is a blood vessel in the kidney.

Learn more about glomerulus at: https://brainly.com/question/28272678

#SPJ1

What is the probability of reinforcement when utilizing an extinction procedure?.

Answers

Extinction is a method that offers no chance of reinforcement.

What is an illustration of the extinction of a behavior that has been reinforced negatively?

The extinction of behaviors that are maintained by negative reinforcement is another variation of this process. This is what is meant by "avoid extinction." Dannie, for instance, sulks when she refuses to consume her food.

Which of the following is an illustration of a behavior that was reinforced positively being eliminated?

For instance, Brian's screaming was positively reinforced by the teachers' social attention to him. Before screaming, he received no attention, but after screaming, he did, and this is how his behavior of screaming was favorably reinforced.

To know more about  reinforcement visit:-

https://brainly.com/question/5162646

#SPJ4

The sequence of nucleotides in a single strand of DNA is shown. TGA - GTG - AAT - CAT. Which of the following represents the complementary DNA strand?
CAG ACA GGC TGC
ACU CAC UUA GUA
ACT CAC TTA GTA
GTC TGT CCG ACG

Answers

Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

4) dna ligase has the ability to relax supercoiled circular dna in the presence of amp, but not in its absence. a) what is the mechanism of this reaction and why does it depend on amp? b) how could you determine that supercoiled dna had in fact been relaxed?

Answers

The mechanism behind the given reaction is the formation of the enzyme-AMP complex. The AMP supports this complex formation. The gel electrophoresis technique will help to determine whether the supercoiling in the DNA has in fact been relaxed.

a) In a three-step process, the ATP-dependent DNA ligases link single-stranded breaks (nicks) in the phosphodiester backbone of double-stranded DNA.  The creation of a covalent enzyme-AMP complex (intermediate) is the initial stage in the ligation reaction.

A highly conserved lysine residue in the ligase's active region is covalently linked to AMP when the cofactor ATP is broken into pyrophosphate and AMP. The 5' phosphate of the nick receives the activated AMP residue, after which the nick is sealed by the formation of a phosphodiester bond and the removal of AMP.

b) The gel electrophoresis technique helps analyze the DNA. This technique uses an electric field to separate the DNA fragments based on size and charge. Supercoiled DNA moves faster than relaxed or open circular DNA in gel electrophoresis. And relaxed DNA migrates slowly and is found closer to the well. This way, we will find whether the DNA is relaxed or supercoiled.

To know more about supercoiled DNA:

https://brainly.com/question/28944211

#SPJ4

identify the blood vessel tunic which contains the specialized simple squamous epithelium called the endothelium. the endothelium is continuous throughout the entire vascular system, including the lining of the chambers of the heart.

Answers

The tunica intima, is the tunica of the blood vessel that contains the specialized simple squamous epithelium called the endothelium. The endothelium is continuous throughout the vascular system, including the lining of the heart chambers.

The Role of the Intima Tunica in the Vascular System

The tunica intima is a layer of the vascular system that contains the simple specialized epithelium, called the endothelium. This layer extends throughout the vascular system, including inside the heart's spheres.

The endothelium is extremely important for cardiovascular health, as it forms part of the barrier between the blood and the tissue cells surrounding the blood vessels. This layer protects tissue cells from the presence of toxic factors in the blood. In addition, it is responsible for maintaining the homeostasis of the cardiovascular system by regulating blood pressure and blood flow.

Learn more about The Vascular System:

https://brainly.com/question/938123

#SPJ4

The meninges are protective membranes that surround the brain. CSF is a liquid found within the meninges that help to protect and cushion the brain, increasing its buoyancy. If a tear occurs in the meninges, CSF will begin to leak, leading to:

Answers

A hole or tear in the dura, the top layer of the meninges, causes a CSF leak. The hole or rip may have been caused by a head injury, brain injury, or sinus injury.

Which of the following qualifies as a blood–brain barrier fundamental characteristic?

The majority of organs and tissues have capillaries, which are slightly leaky and open to the passage of many different substances. The blood brain barrier is a crucial component of the brain's capillaries , which are less permeable due to their very high density of tight junctions.

What kind of cell types are responsible for touch perception?

Touch is transmitted through piezo channels by Merkel cells, which are touch-sensitive cells. There are various types of sensory receptor cells in the Merkel cell-neurite complex.

To know more about CSF visit :-

https://brainly.com/question/15573967

#SPJ4

what kind of virus is hiv? a herpesvirus a paramyxovirus a retrovirus a complex virus a provirus

Answers

Explanation:

Hiv is a retrovirus. Your welcome lol



Which of the following is a characteristic of sexual reproduction? Select all that apply.

A. Requires two parent organisms

B. Offspring are identical to the parent

C. Results in increasing the survival rate of the population

D. Extremely efficient

E. Can occur internally or externally

F. Offspring are genetically unique

Answers

Answer:

A, C, F

Explanation:

A c e f ………………………………..

until recently it was the widely accepted explanation of macroevolution. this model stated that small changes occur at a steady rate over many millions of years. this is the model of evolution.

Answers

Origins, diversifications, & extinctions are examples of macroevolutionary processes that occur on a large scale and require a long period, called geologic time.

Macroevolution includes both studying patterns on the tree of life just above species level and figuring out the mechanisms that are likely to have created these patterns.

Macroevolutionary thinking is useful for providing a more thorough knowledge of the primates' historical evolutionary extinctions. Examples of macroevolutionary processes that take place on a huge scale and require a lengthy period of time, known as geologic time, include origins, diversifications, and extinctions.

To understand such processes, one needs historical evidence, such as fossils from hundreds of millions of years ago or slowly evolving genetic sequences. Broad, protracted evolutionary changes are referred to as macroevolutionary.

Learn more about Macroevolution:

https://brainly.com/question/11751267

#SPJ4

If a triplet on template DNA is AAA, what will be the anticodon on tRNA
a. UUU
b. AAA
c. TTT
d. AUG

Answers

The anticodon on tRNA will be AAA if the triplet on the template DNA is AAA. AAA will be translated to UUU in mRNA if it is found on the template strand of DNA.

The tRNA that would bind to this mRNA has the anticodon sequence AAA. Since AAA is the tRNA anticodon sequence, option B is the appropriate response. A three-nucleotide structure known as an anticodon has the same three bases as an mRNA codon. Each tRNA molecule has a distinct anticodon triplet sequence that can be utilized to make three different amino acid codons by pairing three complementary bases with one or more amino acid codons. Because of wobble base pairing, anticodons can only couple with a single codon.

Learn more about tRNA

brainly.com/question/12830175

#SPJ4

what led to the commercialization of personal genomic products? a. the increase in understanding of genetics and decrease in price of mapping a genome. b. the decrease in understanding of genetics and increase in price of mapping a genome. c. increased awareness of genetics thanks to the human genome project. d. increased demand for genetic mapping products.

Answers

The increase in understanding of genetics and decrease in price of mapping a genome.

The Genetic Code Project was ordered for what reason?

The Genome Project (HGP) was indeed a 13-year, multinational undertaking that ran from 1990 to 2003.The full sequence of DNA bases with in human genome and the discovery of all human genes—which would make them available for future biological research—were the main objectives.

What were the human genome projects' primary objectives?

Accurately sequencing the human genome's 3 billion nucleotide base pairs was one of the project's objectives.The identification and mapping of every human gene found inside the DNA sequence was a secondary objective.

To know more about commercialization of genomic products visit:

https://brainly.com/question/27678392

#SPJ4

in pea plants, the purple allele is sufficient for making purple flowers, even if one of the homologous chromosomes carries the white allele. which of the following statements are true in this case? select all that apply.

Answers

In the pea plant experiment, since the purple allele is sufficient in making purple flowers that means it is dominant in the first progeny.

Gregor Mendel was a 19th-century pioneer of genetics who today is remembered almost entirely for two things: being a monk and relentlessly studying different traits of pea plants. Born in 1822 in Austria, Mendel was raised on a farm and attended the University of Vienna in Austria's capital city.

   In his pea plant experiment he took seven different traits of pea plant such as - tall, dwarf, white, yellow, wrinkled, round, purple. He performed true breeding - means capable of producing one and only one type of offspring, such as when all daughter plants are round-seeded or axial-flowered.

  He observed that the parent generation was the P generation, and it included a P1 plant whose members all displayed one version of a trait and a P2 plant whose members all displayed the other version. The hybrid offspring of the P generation was the F1 (filial) generation. The offspring of the F1 generation was the F2 generation.

Learn more about Mendel's experiment at,

https://brainly.com/question/15136396

#SPJ4

the first fossils of animals with hard parts appeared about 541 million years ago. what percentage of geologic time does the fossil record represent? express your answer as a percentage with two significant figures

Answers

The percentage of geologic time in the fossil record represents 20%.

Remains or traces of previously living things are referred to as fossils. Skeletons, aquatic animal skins, and human and animal imprints on stone are a few examples. The preserved remnants or traces of extinct animals, plants, and other species are known as fossils. Because they demonstrate that earlier life on Earth was distinct from the species present now, fossils are crucial pieces of evidence for evolution. Body fossils (bones and exoskeletons), trace fossils (feces and footprints), and chemofossils are examples of parts of an organism that is typically only partially preserved as fossils (biochemical signals). Paleontologists can classify fossils to establish their evolutionary links between organisms and age them using techniques like radiometric dating.

Therefore, 20% of geologic time is represented in the fossil record.

To learn more about fossils click here: https://brainly.com/question/6867325

#SPJ4

Duchenne muscular dystrophy is caused by a mutation in a gene that comprises 2.5 million base pairs and specifies a protein called dystrophin. However, less than 1% of the gene actually encodes the amino acids in the dystrophin protein. On the basis of what you now know about gene structure and RNA processing in eukaryotic cells, provide a possible explanation for why less than 1% of the gene encodes the dystrophin protein. A. It is likely that the 5′ cap serves as an indicator for a smaller region of the gene to be used for translation of the protein.
B. It is likely that during the splicing process, a majority of the pre‑mRNA is removed in an effort to splice out all the introns.
C. It is likely that the addition of the 5′ cap contributes to the majority of the mRNA degrading, preventing its ability to be used for protein production.
D. It is likely that during the splicing process, a majority of the pre‑mRNA is removed in an effort to splice out all the exons.

Answers

From these data, less than 1% of the genes encode the dystrophin protein because it appears that the 5′ cap serves as an indicator for a smaller region of the gene to be used for translation of the protein.

Option A seems to have the right explanation.

Dystrophin is encoded by the DMD gene. The DMD gene is a large sequence but encodes a single protein. Only less than 1% of this large sequence area is responsible for coding the actual protein. This suggests that the remaining DNA sequence of the DMD gene is occupied by too many double intron sequences spliced from the mRNA transcript before translation can occur.

The researchers found that the DMD gene contains several splice sites which are deleted from the main mRNA transcript after transcription has occurred. The actual exonic sequence in the DMD gene is too small, so the probability of a mutation occurring is very low. This is not a normal case of gene silencing as DMD has mutated lesions in which gene silencing has no effect.

Learn more about the genes that encode dystrophin at https://brainly.com/question/18153814

#SPJ4

examine the age structure diagrams and determine whether each of the countries represented has a growing population, a stable population, or a declining population

Answers

The rate of births and deaths determines population increase. The populations pyramids of various nations are discussed in just this ecological systems theory lecture on age structure diagrams.

A model that forecasts the rate of population growth using a shape is an age structure diagram. The bars depict different age groups from newborns to teens to reproduce to post-reproductive, and the graph displays a comparative ratio for males to girls. An age-structure diagram offers a picture of the current population, can represent historical data, and may offer hints about prospective issues in the future. The breadth of the base should always be compared to the size of the population when evaluating age-structure graphs. Age structure diagrams in nations with rapid development have a pyramidal form, indicating a majority of younger people, many of whom are currently or soon will be of reproductive age.

Learn more about age

https://brainly.com/question/10688919

#SPJ4


Which of the following terms would best describe the
bones that make up your vertebrae?
A flat bones
B irregular bones
C short bones
D long bones

Answers

The answer is B) Irregular bones

The presence of many red blood cells in the urine during a microscopic examination is known as ________.

Answers

Blood in the urine is known as hemoturia. Gross or visible hematuria refers to the presence of crimson or pink urine, which may indicate the presence of blood in the urine. The term "microscopic" hematuria refers to hematuria in which blood occasionally occurs in the urine but is difficult to detect since it can only be seen under a microscope.

Why are there red blood cells in the urine?

The presence of more RBCs than usual in the urine could be caused by: cancer of the bladder, kidneys, or urinary system. kidney damage or inflammation. prostate issues

What does urine with tiny blood mean?

A typical sign of glomerulonephritis, an inflammation of the kidneys' filtering system, is microscopic urinary bleeding. Possibly, glomerulonephritis.

To know more about hemoturia visit:-

https://brainly.com/question/13158065

#SPJ4

what was the consequence of a metal rod driven into the frontal lobe of phineas gage (with similar results to a frontal lobotomy)?

Answers

Gage suffered a intense mind harm from an iron rod penetrating his skull, of which he miraculously survived.

After the accident, Gage's persona changed into stated to have modified because of the harm the frontal lobe of his mind. Gage suffered a intense mind harm from an iron rod penetrating his skull, of which he miraculously survived. The consequences after his injury are that he has gone through profound persona adjustments due to his injury. He is regularly stated as having completely misplaced his inhibitions, in order that he commenced to act inappropriately in social situations.

To learn more about mind check the link below:

https://brainly.com/question/27356012

#SPJ4

compare the urine volume in your baseline data with the urine volume as you increased the blood pressure. how did the urine volume change?

Answers

The urine volume increased proportionally.

An increase in blood pressure while the valve was closed reduced glomerular filtration rate but had no effect on glomerular pressure. However, there was no urine output. When the blood pressure was raised while the valve was closed, the glomerular filtration rate was primarily affected. Because there was no urinary output, the glomerular filtration rate decreased.

Blood pressure is the force of blood pushing against by the artery walls. Arteries are vessels that carry blood from the heart to certain other parts of your body. High blood pressure, also known as hypertension, is characterized by blood pressure that is higher than normal. Your blood pressure fluctuates throughout the day as a result of your activities. Having blood pressure readings that are consistently higher than normal may lead to a diagnosis of high blood pressure.

To know more about the Blood pressure, here

https://brainly.com/question/4215574

#SPJ4

if the trp codons in the trpl gene were mutated to encode another amino acid, what would the result be?

Answers

Answer: If the Trp codons in the trpL gene were mutated to encode another amino acid, what would the result be? The trp operon would never be transcribed.

Janelle was telling her mom about a dream where she was being chased by wolves. She said she ran and ran and when she woke up, her heart was beating rapidly, and she was very tired. Which gland had secreted a hormone that caused her body to respond in this way?.

Answers

Janelle was relating to her mother a dream in which wolves were pursuing her. By testing her we can say its hypothyroidism

Your thyroid gland doesn't generate enough of a few important hormones when you have hypothyroidism (underactive thyroid).

Early on, hypothyroidism may not show any obvious signs. Obesity, joint discomfort, infertility, and heart disease are just a few of the health issues that untreated hypothyroidism can lead to over time.

To identify hypothyroidism, accurate thyroid function tests are available. Once you and your doctor determine the right dose for you, treatment with synthetic thyroid hormone is typically easy, secure, and efficient.

Learn more about hypothyroidism  using this link:

https://brainly.com/question/14724624

#SPJ4

Which skin appendages aid in cooling the body to prevent overheating on a hot day or during intense exercise?.

Answers

eccrine sweat glands.Eccrine sweat glands are the major sweat glands found abundantly on the skin especially in palms

Hope it helps

what are the structural and functional distinctions between the rough and smooth endoplasmic reticulum?

Answers

SER is mainly involved in lipid formation and it doesn’t have ribosomes on its surface whereas RER forms proteins and its surface has ribosomes on it.

The smooth endoplasmic reticulum's primary jobs include lipid synthesis, fat molecule packaging, steroid hormone metabolism, and detoxification. Production and packaging of protein molecules is its primary duty. The main distinction is that the SER surface appears smooth because there are no ribosomal structures on it, whereas the RER surface appears rough because there are many ribosome molecules there.

To learn more about ribosomes please click on the given link: https://brainly.com/question/13061009

#SPJ4

The list shows steps in the process of ocean water becoming salty. Number the statements from 1 to 4 to
describe this process from the start to finish.
________ Rivers carry minerals to the ocean.
________ Water containing minerals flows into rivers.
________ Water from rain dissolves minerals in rocks.
________ Over time, the salt concentration of ocean water increases.

Answers

The process of ocean water becoming salty is as follows

Rivers carry minerals to the ocean.

As rivers flows over the rocks containing soluble minerals, some of them get dissolved in the water. Thus, rivers carry many nutrients from land to the ocean.

Water containing minerals flows into  rivers

water that  flooded carry's minerals .It releases minerals that are carried away to streams and river

Water from rain dissolves minerals in rocks

After a heavy rainstorm, rainwater that falls on land dissolves minerals in rock and soil river. It discharge increases due to surface Gravity pulls river water downhill toward the ocean. Then over time, he salt concentration of ocean increases.

learn more about steps of ocean water becoming salty here brainly.com/question/997618

#SPJ1

Other Questions
according to dr. martin seligman, which property/properties must an element have to be considered an element of well-being? Americans spend a lot of money primarily because PLEASE HELP ASAP. DUE IN A FEW MINS considering higher frequencies, what is the next frequency that will be canceled out upon reflection with this distance between rows? Which organizational method would produce the most sequential research report on the discovery of gold in 1848?. Amniocentesis and chorionic villus sampling allow for ________ and ________ of the fetus so that it can be tested for abnormalities. The um of all of your cutomer Account Receivable i lited a part of _______________________ on your balance heet Which of the following terms is used by ecologists to describe the community interaction where one organism makes the environment more suitable for another organism?A) parasitismB) mutualismC) inhibitionD) facilitationE) commensalism A researcher wants to test the hypothesis that on average girls perform better on standardized tests than boys. Since it is true that some boys do better than girls and some girls do better than boys, the researcher must use a two tailed test.True OR False Beryl enters into a contract with Clay for a guided tour of Deep Canyon. Clay represents that he is an experienced, knowledgeable guide, when in reality he has never been in the canyon. Most likely, Beryla. could exert duress to obtain a new guide.b. can rescind the deal based on fraudulent misrepresentation.c. might recover damages for the mistake.d. must comply with the contract because the representation is an opinion. at what speed, as a fraction of c , will a moving rod have a length 60% that of an identical rod at res An IT company has a HealthCare application with data security requirements such that the encryption key must be stored in a custom application running on-premises. The company wants to offload the data storage as well as the encryption process to Amazon S3 but continue to use the existing encryption keys.Which of the following S3 encryption options allows the company to leverage Amazon S3 for storing data with given constraints? BEGINNERS COMP. SCI JAVA CODING PLEASE HELP!!!(All questions shown in picture please!) According to Edwards, which is greater: the power of god or the power of kings? And why? your estimate of the market risk premium is 6%. the risk-free rate of return is 4% and general motors has a beta of 1.4. what is general motors' cost of equity capital? discuss how the managerial succession process and the composition of the top management team interact to affect strategy. then, you need to develop a specific healthcare strategy/vision for your company based on those identified challenges. lastly, develop 4 hr initiatives/hr actions that could be taken to support/execute your strategy. you will need to provide some detail, that is, the actual actions that you would take to support your chosen strategy. the only valid reason for following the peculiar strategy god gave israel for jericho was faith in god and obedience to his word. true false why did americans write to congress about the supplement regulation bill? did they support the bill for stronger regulation or oppose it? which nutritional assessment data should the nurse collect to best reflect total muscle mass in an adolescent? Steam Workshop Downloader