Answer: DNA
Explanation: The RNA is a big affect on the DNA because, there will be no repairs of the DNA leading to cancer
give two examples of asexual Productions
Answer:
Asexual Reproduction Examples
Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v
16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits
Answer:
C
Explanation:
The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.
There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.
A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.
Hence, the correct option is C.
tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed
Answer:
Naruto usamaki is the greatest hokagey in the leaf village
Can someone please help me I don't understand the and my parents don't under please
432hz x 432hz = 2228
Explanation:
the simple explanation is shushh
1) BB x bb (B=Brown, b=blue) 2) Aa x Aa (A=Tall, a=short) 3) DD x Dd (D=Rough,d=smooth) 4) Ee x ee (E=Stripes, e-soild). ? help someone
Answer:
1) Brown, 2)Tall with a 25% chance of short 3) Rough 4) 50% chance of solid 50% chance of stripes
Explanation:
The big letters are the dominant. Dominant always shows up if its part of it. The genetic squares show that any square with a Big letter will present the big letters trait. i didnt really understand so i hope this is what you're looking for
rko vs claymore who will win
Answer:
claymore duh
Explanation:
Answer:
claymore
Explanation:
Why most foods needs to be digested? Give at least 3 reasons
Answer:
Why most foods needs to be digested? Give at least 3 reasons.
Explanation:
Foods must be digested cause of the following reasons:
1. To get energy the food must be digested.
2. To provide nourishing vitamins and minerals to our body.
3. You will be affected by some diseases if you didn't digest your food.
Jimmy and Marquis are conducting an experiment in class. They have
planted four seeds in four different pots. They placed the pots in different
places around the classroom: in a sunny window, on the work table, on the
floor near the window, and under the boys' desk. The boys watered the
pots every morning when they arrived at school. Once the seeds sprouted
the boys measured how much each seed grew. "Wowl" said Marquis, after
3 weeks of observing and measuring, "I can tell which seed was under our
desk!" Can you? Which seed was placed under the boys desk?
Measuring Plant Height
10
Plant Height (Inches)
Seed 1 Seed 2 Seed 3 Seed 4
I WILL GIVE BRAINLIEST
Use the image to answer the question.
The image shows a food chain. An arrow points from grass to a grasshopper. An arrow points from the grasshopper to a lizard. An arrow points from the lizard to a hawk. An arrow points from the hawk to a fox.
What would happen if the number of grasshoppers in this food chain decreased?
A.
The amount of grass would increase.
B.
The number of lizards would increase.
C.
The amount of grass would decrease.
D.
The number of hawks would increase.
Answer:
a, the amount of grass would increase
Explanation:
if the grasshopper is the one in this diagram eating the grass, and suddenly there were fewer grasshoppers to do that, the grass would increase because more of it can grow without being eaten
explain in details the mechanism of transportation in plants
Answer:
Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.
Explanation:
I hope I helped:)
Answer 15 and 16 correctly and I will mark as brainliest
Answer:
I think its A and G
Answer:
15. B.
16. H
Explanation:
The diagram shows four pairs of chromosomes from the karyotype of a normal human male.
Select the pair of sex chromosomes.
Answer:
According to the karyotype image, the sex chromosomes of a normal human male are those of the last picture, where both are different.
Explanation:
The sex chromosomes are those that determine the sex in a species, as in the human being and other species X and Y. XY chromosomes determine the male sex while the XX sex pair corresponds to the female sex.
In humans, the chromosomes are grouped by pairs with the same characteristics, that is, most pairs of chromosomes are identical. The only exception is represented by the male human sex chromosomes X and Y. This difference in the sex chromosomes causes the different sex chromosomes (picture) to be called heterogametic.
Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto
What determines which bases will be brought to the DNA strand during DNA replication?
which is NOT part of the cell theory?
A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things
Answer:
B.
Explanation: Hope this helps! ^^
multiple choice
Daytime temperatures on Mercury are extremely hot because:
1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes
Answer: it has long days
Explanation:
How does biology affect behavior?
Answer:
some behaviors may have a genetic basis, but genes do not actually control behavior. Rather, our genetic makeup influences how we interact with and respond to our surroundings.
Explanation:
There you go
What is the difference between a molecule and a diagram of a molecule ?
Answer: The molecule itself is the actual thing present.
while the diagram explains what makes up a molecule or what it looks like structurally
Explanation:
Write any three differences between mass and weight
please its aurgent fast
Answer:
See explanation
Explanation:
There are a number of differences between mass and weight, they include;
Mass is a scalar quantity whereas weight is a vector quantity.
Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.
The SI unit of mass is kilogram whereas the SI unit of weight is Newton.
When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?
The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.
Answer:
The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.Explanation:
Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2
Answer:
40kg
Explanation:
F=M*A
M=F\A
M=400\10
M=40kg
The mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2 is 40 kg.
What is acceleration due to gravity?The net acceleration that objects get as a result of the combined action of gravity and centrifugal force is known as the Earth's gravity, or g.
It is a vector quantity whose direction, strength, or magnitude match a plumb bob.
According to Newton's second law, an object's acceleration is inversely proportional to its mass and directly connected to the net force. An object's acceleration is determined by two factors: force and mass.
We know that,
F = m x g
m = f/g
Where,
F = force
m = mass
g = acceleration due to gravity
Given that,
F = 400N.
g = [tex]10m/s^2[/tex]
So,
m = 400/10
m = 40 kg.
Thus, the mass is 40 kg.
For more details regarding acceleration due to gravity, visit:
https://brainly.com/question/13860566
#SPJ6
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
when an experiment shows that two variable are closely related the experiment shows what
Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.
Explanation:
To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement
Answer:
paper bags jute bags , cotton bags might be used for the environment
MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?
Answer:
Due to its high intelligence.
Explanation:
Scientists think that cuttlefish have the biggest brain to body ratio of all invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.
What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?
Answer:
Spiral Galaxies, Elliptical Galaxies & Irregular Galaxies
Explanation:
How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.
Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?
Answer:
Abnormally high temperature
Explanation:
Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.
When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.
please help
Explain how an organ and organelles are related
Answer:
Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.
Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.
What is the relation between organ and organelles?Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.
Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.
Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.
Therefore, organ and organelles differ in their functioning.
Learn more about organ and organelles here:
https://brainly.com/question/22911736
#SPJ2
Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D
Answer:
C
Explanation:
it has the example figure number 7 and also it has the correct bisector