Identify the factor below as genetic or environmental factors that may influence susceptibility to disease?

Answers

Answer 1

Answer: in order age to exercise,

genetic, environmental


Related Questions

help please 30 points will give brainliest
Plants release the waste ___________ during cellular respiration and ____________ during photosynthesis.

fill in the blanks

Answers

Plants release the waste carbon dioxide during cellular respiration and oxygen during photosynthesis.

which are examples of steroids? A. testosterone and trans fats B. cholesterol and phospholipids C. cholesterol and vitamin D D. estrogen and phospholipids

Answers

Answer:

A

Explanation:

because it really is suppose. to make u more stronger tougher and high testosterone.

distinguish between active and passive immunity​

Answers

Answer:While active immunity occurs when an individual produces antibodies to a disease through his or her own immune system, passive immunity is provided when a person is given antibodies.

Explanation:

during an experiment scientists study a portion of a gene found in the white mouse. they determined that the following sets of codons has been translated into a series of three animo acids shown below
mRNA sequence- GCA-UUA-UCG
amino acids sequince- alanine - leucine - serine
which of the following would be the expected outcome of this same set codons were to be found in humans genes
The human cell would be unable to translate the mRNA codons.

The sequence of amino acids would be completely different in the human.

The amino acid sequence would be identical in the human cell.

The human cell would be converted into a mouse cell.

Answers

Answer:

the amino a acid sequence would be  identical to human cell

becuuse the codes sequencing is simialr in all animals

I need help with this

Answers

Answer:

what is the name of this website

or the book?

Explain why only certain substrate can combine with enzymes.
Help me please​

Answers

Answer:

sry i cant i too dubm need points tho

Explanation:

How does competition limit the amount of individuals in populations?

Answers

Answer:

Due to competition, many animals starve, many become prey, etc.

Explanation:

Explain how organisms in both of the ecosystems are dependent on their environmental interactions with other living things and with nonliving factors.

Answers

Answer:

Explanation:Organisms, and populations of organisms, are dependent on their environmental interactions both with other living things and with nonliving factors. ... Mutually beneficial interactions, in contrast, may become so interdependent that each organism requires the other for survival.

The organism that considered for an ecosystem that should be dependent on the environmental interactions should be explained below,

Environmental interactions:

The organism and the organism population should be based on the environmental interactions along with the other living things also even with the non-living things of factors.

On the other hand, Mutually beneficial interactions should be considered as the independent where each and every organism should needed other for the survival purpose.

learn more about an organism here: https://brainly.com/question/18167856

5 5. Normally, the temperature inside the scrotum is slightly lower than normal body temperature. What do you predict would happen if the temperature inside the scrotum were a few degrees higher than normal body temperature instead? A. Sperm would not be able to travel through the vas deferens. B. Sperm would be stored in the epididymis rather than in the testes. c. Sperm would not be able to develop properly. D. The rate of sperm production would increase,​

Answers

Answer:

C. Sperm would not be able to develop properly.

Explanation:

There is an optimum temperature where sperm production is at its best. An increase or decrease in temperature may affect the quality and quantity of the sperm.

If the temperature inside the "sc-rotum" raises by few degree than normal body temperature, than the "sp-erm" would not be able to develop properly.

What is the function of "sc-rotum"?

A pouch, which is suspended from the groin, and comprising the "tes-tes" and some of the male "s-ex" accessory ducts is known as the "sc-rotum". The prime function of the "sc-rotum" is to maintain the temperature essential for the process of "sper-matogenesis", that is, by situating the testes external of the body cavity.

Within the human "sc-rotum", the temperature is 3.1 degree C lesser than the usual temperature of the body. In case, if the temperature elevates of the "sc-rotum", the degeneration of the germinal epithelium will take place, which will eventually result in sterility. Therefore, for the production of sperms within the testes, a lower temperature is needed, otherwise the development of the "sp-erm" will not take place appropriately.

Thus, the correct answer is option C.

Find out more information about the function of "sc-rotum" here:

https://brainly.com/question/940283

Describe some of the changes in the land and in life-forms that occurred at the end of the Paleozoic Era.

Answers

during the end of the paleozoic era it was probably one of the greatest mass extinctions on earth and the land started to break up and move around to form what the world looks like today

What type of graph is used for a PH test

Answers

Explain why a line graph is used for the pH data. Line graphs are utilized when data is continuous. It’s either a line graph or bar graph but usually line graph

What nitrogen base does Cytosine pair with

Answers

Answer:

Guanine

Explanation:

There are four nitrogenous bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine)

Adenine always bonds with thymine, and cytosine always bonds with guanine.

Describe Why are trochophores of interest to biologists?

Answers

Answer:

Because it is also one of the larval stages in some other groups of invertebrates, and are used by biologists to deduce evolutionary relationships among different groups of invertebrates

Explanation:

hope it will help you.

A one-hectare forest community is sampled in early August. The sample yields 12 small trees, 4 types of vines, as well as 17 native shrubs that represent 10 species. What can be estimated from the sample for the shrubs in the forest community?

A. the forest’s productivity

B. the species richness

C. the degree of forest disturbance

D. the stability of the ecosystem

E. the uniformity of species distribution in the ecosystem

Answers

Answer:

The correct answer is - B. the species richness

Explanation:

Species richness determines the numbers of different species are present in an ecological community. It is a numerical value or count of different species present in a particular community.

The given information or data can only be used to estimate the species richness in the particular forest community as there is data available about the number of species presnt in this community.

What is the range for the following set of measurements?
3.1 mL, 2.7 mL, 4.6 mL, 1.9 mL, 8,7 mL

Answers

The range of the set is 6.8,
because 8.7-1.9=6.8

The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external factors in its environment? A. A decrease in the number of fish causes bears to start consuming more plants. B. An increase in hunting causes bears to stay in covered areas and avoid humans. C. A decrease in temperature causes bears to look for food during the day instead of at night. D. all of these

Answers

Answer:

D. all of these

Explanation:

I just got it right in study island (:

Answer:

it's D

Explanation:

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

The shark still has identical skeleton to previous sharks. What other way can you prove evolution occurred if fossil evidence does not show any?

Answers

There is biogeography comparative and anatomy and comparative embryology and molecular biology

Why might parents who don't show the trait of albinism have children who do?

Answers

Answer:

This trait is rare when it occurs. Some genes depend on other genes to be expressed, so in most cases a trait is denied an expression. But its still there, so it passes down to generation until it gets expressed.

Explanation:

Answer:

Because it's a recessive trait

Explanation:

There are two chromosomes that determine your biological sex: XX for the female and XY for the male. You inherit one X chromosome from your mother and one X or Y chromosome from your father, which is what determines your sex.

A certain inheritable genetic condition can be recessive or dominant. If it's dominant, it shows even if just one chromosome carries that condition. If it's recessive, it has to be in both ones (or just the x one or just y if you're male. That's why some conditions, such as daltonism, affect men more that women).

For example, blue eyes are a recessive trait, brown eyes are a dominant trait. If your parents are both blue eyed, you will surely have blue eyes as well. The same can't be said if both of your parents have brown eyes: they might still be carrier of the blue eyed trait (both of them have to), in which case you would have a 25% chance (1/4) to have blue eyes (½ to inherit the carrier chromosome from your mother; ½ from your father). The same can be said about albinism

3) identify and describe three abiotic characteristics of ecosystems. Give an example of how each

characteristic could be affected by a human activity

Answers

Answer:

The abiotic characteristics of an ecosystem that affects man includes: Land surface, rainfall and relative humidity.

Explanation:

In the ecosystem, man occupies the terrestrial habitat which is affected by the abiotic factors listed above.

Abiotic (non- living) factors determine the type of biotic (living) community that is found in an ecosystem. These factors include Land surface, rainfall and relative humidity, just to mention a few.

--> LAND SURFACE: This is responsible for the marked variation in the vegetation of a place. For example, a mountain in the tropics may have a rain forest vegetation at it's base and an afroalpine vegetation near its peak. The gradient of the slope affects the growth of organisms. A steep slope encourage fast run - off of water and therefore encourages erosion, which results in shallow and infertile soil. This in turn AFFECT man's farming activities as there would be little to no crop yield.

--> RAINFALL: Water is a very important abiotic factor that affects life. The main source of water to terrestrial habitat is rainfall. When rain falls, a greater percentage of it sinks into the soil while the rest run- off into water bodies. Water is absorbed by root hairs into the plant and used for photosynthesis to produce food. The absence of rainfall in the environment of man could lead to drought which AFFECTS man negatively.

--> RELATIVE HUMIDITY: This is a measure of the amount of moisture in the atmosphere. It's usually high in hot wet regions. It affects the rate at which water evaporates from the body surfaces of organisms. Low relative humidity cause more water (sweat) to evaporate from body surfaces giving the human body a cooling effect. But in high relative humidity, the sweat cannot evaporate leaving the body feeling hot and sticky. This AFFECTS man as the body tries to cool off in a harder way by increasing rate of respiration and depth of blood circulation.

DNA double helix. Hydrogen bonds break and helix opens. Each strand of DNA acts as a template for synthesis of a new, complementary strand. Replication produces two identical DNA double helices, each with one new and one old strand.

Answers

Answer:

The process described above is known as DNA replication.

Hope this helps you! Have an amazing day!

The real length of one villus is 0.8 mm
Calculate the image length if the villus is viewed at a magnification of x20

magnification = size of image / size of real object

Answers

Answer:

Explanation:

Re arrange formula=Size of image=Magnification*size of real image

0.8mm*20=16mm

The image length will be "16 mm". A further explanation is below.

Given:

Magnification,

20

Size of real image,

0.8 mm

As we know the formula,

→ [tex]Magnification = \frac{Size \ of \ image}{Size \ of \ real \ image}[/tex]

or,

→ [tex]Size \ of \ image=Magnification\times Size \ of \ real\ image[/tex]

By substituting the values, we get

→                         [tex]=20\times 0.88[/tex]

→                         [tex]= 16 \ mm[/tex]  

Thus the response above is correct.

Learn more:

https://brainly.com/question/24716995

Which of the following is NOT an example of a biotic factor in an ecosystem?
F.
Grasses
G.
Bacteria
H.
Beetle
J. Water

Answers

the answer is h. beetle

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

Help!!
Cells of the skeletal system are specialized in their structure to store minerals. Which of the following is the function of these cells?

Produce chemicals that transmit signals.

Prevent the spread of disease in the organism.

Provide support to the body.

Absorb excess water released by digestion.

Answers

Answer: Provide support to the body.

Explanation:

The skeletal system is a system which is formed by the bones. The bones are important for the structure and function of the body. The bones are connected with the muscles to allow the movement of the body, and they protect the vital organs like heart, lungs, brains, and others. They provide support to the soft tissues, organs, and muscles of the body. They keep the human body upright. The skeletal system provide shape to the body. It provides support by acting as regions of attachment of soft body parts and muscles.

Organisms are classified into Kingdoms based upon basic characteristics. An organism has a nucleus in its cell, is multicellular, and produces its own food for energy through the process of photosynthesis.

Answers

Answer:

kingdom plantae because of process of photosynthesis

state the taxonomic family to which the virus that causes EVD belongs​

Answers

Ebolavirus, genus of viruses in the family Filoviridae, certain members of which are particularly fatal in humans and nonhuman primates. In humans, ebolaviruses are responsible for Ebola virus disease (EVD), an illness characterized primarily by fever, rash, vomiting, diarrhea, and hemorrhaging.

Describe how Mendel performed his pea plant experiments.

Answers

Answer:

Every offspring does not look alike they change with the generations

Explanation:

Vacuoles are found in plats, animals, and single-celled organisms.
In plants, vacuoles can occupy up to 90% of the cell while in animals, vacuoles are much
smaller and also help store ions and nutrients.
Single-celled organisms that live in aquatic environments like the paramecium, have a
contractive vacuole to maintain homeostasis.
Based on the information given, how does a vacuole help an organism maintain homeostasis?
A. It helps by regulating water amounts within the cell.
B. It helps by keeping a rigid structure at all times,
C. It helps by excreting salt as part of osmosis
D. It helps by controlling the movement of gases into the cell.

Answers

Answer: c

Explanation: because it helps by excreting

3. In the image, which letter represents the enzyme?
a. Letter A
b. Letter B
c. Letter C
d. Letter D

Answers

Answer: The answer is C

Explanation:

The correct option is, (c) Letter C.

What is the enzyme?Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial. Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

How do you classify enzymes?

According to the sort of process they catalyze, enzymes are divided into six categories:

Oxidoreductases. Transferases.Hydrolases.Lyases.Ligases.Isomerases.

What are the 7 enzymes?Depending on the type of reaction they catalyze, enzymes can be divided into seven different types. These groups include hydrolases, lyases, isomerases, ligases, translocases, oxidoreductases, transferases, and hydrolases.

What is enzyme structure?Proteins called enzymes are made up of amino acids connected by one or more polypeptide chains. The fundamental structure of a polypeptide chain refers to this arrangement of amino acids. This in turn dictates the enzyme's three-dimensional structure, including the active site's shape.

Learn more about enzyme here:

https://brainly.com/question/1596855

#SPJ2

Other Questions
Which best explains the motivation of a student who wants to graduateat the top of her class?(A) Belongingness need(B) Influence of an individualistic culture(C) Optimal arousal(D) Influence of oxytocin and vasopressin(E) Growth needs A single line of four cats one behind the other walks towards and head-on into a single line of five cats walking in the opposite direction. When two of the nine cats meet, they both switch directions and then continue walking. How many meetings take place? The following data show the average retirement ages for a random sample of workers in the United States and a random sample of workers in Japan. Perform a hypothesis test using = 0.05 to determine if the average retirement age in Japan is different from the United States. Calculate the test-statistics (round to 3 decimals - report the absolute value). An engineer stands 50 feet away from a building with a surveying device mounted on a tripod. ifthe surveying device is 5 feet above the ground and the angle of elevation is 50, find how tall isthe building. 13. Describe and correct the error in finding the product.X (x 5) = x 52 = x2 - 25 Solve for 0 Round your answer to the nearest tenth.2013A =degrees Paulo has a receipt from a restaurant. The total amount is blurred, but he knows he left a $4.25 tip, which was 20% of the cost of the meal. How much did his meal cost? How much did he spend in total?No random answers pls a) Das ist _____ Englischraum. Klasse, oder? Wir lernen hier Englisch, Deutsch undSpanisch.1) unser 2) ein 3) unsereb) Sehr nett. Wir haben _____ Sprachlabor. Wir haben Englisch in dem Klassenzimmer.1) keinen 2) keine 3) keinc) Und hier ist _____ Chemieraum.1) unsere 2) der 3) eind) Wir machen hier _____ Experimente. Das macht Spa.1) eine 2) unser 3) -e) Habt ihr auch _____ Physikraum?1) ein 2) unseren 3) einenf) Nein, es gibt _____ Physiklabor.1) - 2) kein 3) keineng) A: Und wo sind wir jetzt?B: Nett, oder? Hier gibt es _____ Bibliothek.1) der 2) unser 3) unsereh) A: Und wo habt ihr Musik?B: Hier ist _____ Musikraum. Wir singen hier und spielen Instrumente.1) unsere 2) der 3) diei) A: Habt ihr _____ Schulmensa?1) ein 2) - 3) eineB: Ja. Wir essen hier zu Mittag.j) Und das ist _____ Sporthalle. Wir spielen hier1) eine 2) unsere 3) unserk) Hier sind wir in _____ Lehrerzimmer.1) der 2) dem 3) einl) Das ist _____ Bro des Direktors.1) ein 2) das 3) diem) Und hier sind wir zurck in _____ Halle.1) der 2) dem 3) unser La base del idioma espaol es el latn vulgar que se impuso a las lenguas ibricas, el anterior enunciado es: Help? I dont understand this math Which of these objects is made of cells?A. rocks B. snow C. trees D. water Find the area of a circle with a radius of 3. What conditions in the Roaring '20s marked the end of the Progressive Era?A. Shrinking income disparities and growing economic equalityB. Civil rights reforms ending segregation and discriminationC. Reduction in business taxes and government spendingD. Legislative successes that rendered unions obsolete 3 facts about baroque art style? There are 180 trees in gardner grove orchard, and 18 of them are pears. What percent of the trees are pear trees? Water in a 14mm diameter pipe flows at 2m/s. How many liters flow along the pipe in 1 minute Arletta built a cardboard rampfor her little brothers toy cars.Find the volume of this ramp. pros and cons of being part cosplay subculture. How does human consumption of limited resources (energy), impact the biosphere? PLS ANSWER QUICK, HELP Steam Workshop Downloader