How do the activities of marketing for value fulfill the marketing concept for the market-oriented organization

Answers

Answer 1

Answer:

How do the activities of marketing for value fulfill the marketing concept for the market-oriented organization

Explanation:

How do the activities of marketing for value fulfill the marketing concept for the market-oriented organization


Related Questions

Which of the following types of companies provide personal liability protection for their owners?

A. Sole proprietorships and partnerships
B. Hierarchical companies and matrix organizations
C. Corporations and LLCs
D. Trademarked and licensed companies

Answers

Answer: C

Explanation:

Answer:

Corporations and LLCs

Explanation:

they are usually private and they are kept separate from their owners.

Which people in government and public administration act as first responders during emergencies?
Law enforcement professionals, such as ________, act as the country’s first responders during emergencies, such as natural disasters.

Answers

Answer:

see below

Explanation:

Law enforcement professionals, such as firefighters, emergency medical technicians (EMT's), state police offices, and paramedics, act as the country's first responders during emergencies and natural disasters. The U.S. marshals, deputy marshals, and the military may also be called depending on the gravity of the disaster.

The law enforcement professionals' core mandate is to protect citizen's lives and property. During emergencies, law enforcement agencies are always called upon to execute their mandate with speed and the utmost care.

It's 2021! Happy new year! How do you like this new year so far?

Answers

Answer:

its okay i guess..

Explanation:

Sor far my year is going amazing!

Question 5 of 10
One example of a short-term savings strategy is:
A. a free checking account.
B. an employer-sponsored 401(k) plan.
C. a low-interest bank account.
D. a high-risk stock market investment.

SUBMIT

Answers

Answer:

A. a free checking account.

Explanation:

Saving involves putting money aside in a safe place for future use. Banks and financial institutions offer saving accounts as safe and secure platforms for firms and individuals to save.

A checking account is among the types of savings accounts offered by financial institutions. This type of savings account allows customers to save money that they do not wish to spend immediately. A checking account is risk-free and, therefore, a good strategy for short term saving.

Answer:

a low-interest bank account.

Explanation:

i got this right

when they use internet ads marketers get their audience involved by using interactive content suck as​

Answers

I believe the answer is A hope this help have a good day

Answer:links and surveys

Explanation: took the test

I need help please n thanks

Answers

Answer:

The first foundation is called THE foundation  You need to maintain a accurate balance so you can keep track

Explanation:

Using the chart, identify an example of absolute advantage for the United States over either Country A or Country B. Be sure to identify the product and the country. Explain how the availability and use of a natural resource may impact advantage.

Answers

Answer:

Absolute advantage is the advantage that a country has when it can produce a particular good or service at a lower cost than other countries.

Explanation:

The United States, in particular, has absolute advantage in the production of oil. Currently, the U.S. is the largest oil producer in the world, with around 15 million barrels a day.

This advantage occurs because the United States has ample oil deposits, both conventional and non-conventional (non-conventional deposits are those that can only be exploited through fracking), and also because the U.S. has the technical capacity, both in terms of infrastructure and human capital, to exploit those oil deposits in a satisfactory manner, and more importantly, in a more efficient and cheaper way than most other countries in the world.

1. Your older sister, Anna is trying to figure out how she's going to pay for college in the
Fall. Anna is going over her options with you one night and she narrows it down to
either putting her college education on your parents' credit card or taking out a
student loan. Which one would you suggest and why?
I
2. Anna then tells you a story about her friend, Chad. Chad has a Target credit card that
he opened a few months ago. The other day he tried to use his credit card to buy
popcom at the movies, but it was denied. Explain to your sister why this happened.

Answers

1.) student loans due to the fact that they are more secure than credit card debt and maybe have long periods before they have to be paid off.
2.) chad has a maximum amount of money he can use before it has to be paid back. Unfortunately chads maximum was so low he couldn’t even buy popcorn, or he already maxed out his card.

Controling does not require any process comment

Answers

what’s the question?

Since water transportation is so much slower than other modes, why do companies choose it?


Water transportation is unaffected by delays for maintenance, scheduling, and weather, making it far more reliable.

Some companies might think it's worth the lost time when they are shipping potentially dangerous products.

The environmental impact of water transportation is lower, so companies can justify its use.

Some companies prioritize cost as their overriding concern for their shipping requirements.

Answers

Answer:

i think its d or maybe a

Explanation:

Answer:

ah

Explanation:

A company with two factories learns that by using robots and other high-tech
equipment it can produce the same quantity with just one factory. It decides
to close one of its factories. Under the WARN Act, who must be notified of
this decision?
O A. The workers at both plants and the state and federal departments
of labor
OB. The workers of the plant to be closed, the local government, and
the state's department of labor
O C. The workers at the plant to be closed, the local government, and
the state's dislocated-worker unit
O D. The workers at both plants, the local governments of both
communities, and both states' dislocated-worker units

Answers

Answer:

O C. The workers at the plant to be closed, the local government, and

the state's dislocated-worker unit

Explanation:

The WARN Act seeks to offer protection to workers, their families, and communities by compelling employers to give a 60 notice day in advance of a planned plant closure or intended mass layoffs. The advance notice provides workers and their families time to adjust to the pending loss of employment. It accords workers some time to seek alternative employment or acquire new skills to compete for jobs.

Apart from the affected workers, The WARN act requires employers to notify the state dislocated worker units. This facilitates dislocated worker assistance to be availed promptly to the affected worker. The local government representatives should also be notified.

Help PLEASE!!!

Joel works as a customer service representative in an electronics store. A customer has a complaint regarding a technical aspect of the computer
he bought from the store two weeks ago. Although Joelis familiar with the specifications of the computer, he is fully equipped to help the
customer with the complaint. Assuming that Joel possesses good customer service skills, which action should he toket

A. use the internet to find the required information and help the customer
B. ask the customer to wait while he has a meeting with his manager
C. help the customer contact the store's engineer who can provide help regarding technical issues
D. ask all members of his staff whether they have a solution to the customer's problem
E. politely tell the customer that nobody could possibly solve the problem

Answers

Answer: C

Explanation: since she is customer support the obvios (god i cant spell sometimes) thing to do is connect them to a engineer who can help them. you could also do process of elimination A: they probaly did search the internet already B: why the manager? wouldnt someone like an engineer have better insight on this? C: Engineers have the most expertise in this area so they can help fix the problem. D: sure this could help but its not as sure as asking the engineer

ANSWER: C

Joel being as a customer service representative in an electronics store shall help the customer contact the store's engineer who can provide help regarding technical issues. Option C is correct.

What is Customer Service Representative?

Customers who have inquiries, requests, or concerns regarding goods or services they have received from the business are assisted by a customer service representative.

At every stage of the process, they give priority to the demands of the clients and offer solutions that are tailored to those unique circumstances.

Essential Characteristics of an Outstanding Customer Service Representative has problem-solving abilities. The most important trait for providing outstanding customer service is problem-solving, followed by clear communication, friendliness, empathy, business savvy, goods knowledge, and strong time management.

Thus option c is correct.

Learn more about Customer Service Representative refer:

https://brainly.com/question/20910726

#SPJ5

Rather than the borrower paying a small rate of interest in each cycle like with a credit card, the borrower using a payday loan...

Answers

Answer:

Rather than the borrower paying a small rate of interest in each cycle like with a credit card, the borrower using a payday loan... doesnt make you go thourgh the cycle of interest.

Explanation:

Answer:

No, paying from a credit card is more preferable .

Explanation:

The borrower paying a small rate of interest in each cycle like with a credit card, the borrower using a payday loan :

No, since the interest charged by her credit card will be less than the interest charged by the payday lender. Usually, the sum given to you by the payday loan specialist is as of now net of interest. So, in the event that you connected for an advance of $100, you may be given a sum less than $100 but you still need to pay for $100. The brief span of time the payday lender has, it charges the next interest than that of a credit card. You merely pay interest on your credit card once you have an exceptional adjustment at the conclusion of the month to month cut-off. On the off chance that you pay off the entire extraordinary sum inside the cut-off, no intrigued will be charged.

Know more :

https://brainly.com/question/14366568?referrer=searchResults

1. Do you think it's really important to start saving for retirement as early as possible? Why or
why not?

Answers

Yes, I think it is important to save for retirement as early as 18 years old. I think this so that if anything goes wrong you can have kind of like a safety net.

Why do older kids think they know every thing?

Answers

Answer:

I have no clue tbh lol they think they are the boss of us

Because technically they do , when you turn a adult don’t you know stuff more when you were a kid ? For example a kid who is 6 is gonna know how to walk then a kid who is 1 :)

which of these is an official policy act of government against each other?

a) boycott
b) embargo

Answers

Embargo is the answer

Which of the following is not a strategy for fostering customer relationships?

A.Run contest where customers have to answer questions or enter a lottery

B.Ask customers to fill out satisfaction survey and immediately respond to complaints

C.Share mailing lists with other companies who want to sell customers similar products

D.Establish a blog and provide customers with useful information unrelated to the product

Answers

Answer:

I would say B or D sorry if its wrong

Answer:

establish a blog and provide customers with useful information unrelated to the product

Explanation:

PLEASE HELP ME!!!!! I need to know the best ways to make a small business known. I just started a small Scentsy® business with my mom. I don't do social media and my moms is mainly her private friends even though it is public.

Answers

Answer:

Buy ads and get social media

Explanation:

why only 4 percent manage to succeed in business of company ??​

Answers

Answer:

A lot of businesses don't succeed due to money problems, or no customers.

Explanation:

It takes tons of money to build up a business, its hard to get people to work for you, you’ve got to pay people to do things, it costs a ton. it’s hard!

Car dealer ben carte paid 97 percent of the base price of 22,567. he also paid 93 percent of options totaling 3,465. and a destination charge of $650. what is the dealers cost

Answers

Answer: im also working on my school work and i also need help i tried to work on that question im confused but i know that 22,567-97% is 677.01

Which people in government and public administration act as first responders during emergencies?
Law enforcement professionals, such as ________, act as the country’s first responders during emergencies, such as natural disasters.

Answers

Answer:

see below

Explanation:

Law enforcement professionals, such as state police offices, general law enforcement officers, firefighters, emergency medical technicians (EMT's) paramedic act as the country's first responders during emergencies, such as natural disasters. In some situations, the U.S. marshals, deputy marshals, and the military also respond to emergencies.

The principal responsibility of law enforcement officers is to protect citizen's lives and property. In times of emergencies, law enforcement agencies are expected to execute their mandate with care and speed.

The legal form of business ownership that is owned by two or more people is a ____
a) corporation
b) partnership
c) sole proprietorship
d) limited liability company
PLEASE HURRY FIRST CORRECT ANSWER GETS BRAINLIEST AND 15 POINTS

Answers

Answer:

b

Explanation:

partnership

You have two employees who report directly to you. One is making $36,000/year and the second is making $24,000/year. You feel the second employee has done outstanding work, and you want to give her a $3,000/year raise. The company has limited you to a total increase in payroll of 5% for next year. How much of a raise can you afford to give to the first employee if you give the second employee a $3,000/year raise?

Answers

Answer:

Zero,( no raise at all)

Explanation:

The total labor cost for the two employees is

=$36,000 + $24,000

=$60,000

If only 5% of increases in payroll is approved, the actual increase

=5/100 x $60,000

=0.05 x $60,000

=$3,000

If the second employee is to get a raise of $3,000 per year, then the first employee will not get any raise.

According to the article, how can you guarantee that your talk or speech will be interesting to your audience? Is this good advice? Why or why not? Justify your response.

Answers

Answer:

7 c's of communication

Explanation:

Talk or speech needs to be interesting for audience, to attain the desired goal of communication.

The public communication would be effective & interesting ; if it satisfies 7 c's of communication - Clear, Concise, Correct, Coherent, Complete, Courteous, Considerate.

Communication not satisfying one or many of above C's is likely to be ineffective &, or uninteresting for audience

What are Advantages of having good Credit Score? Choose the best three that apply.

Saving on Insurance rate
Car loan Interest rate
Getting in to a Good College
Getting a Good Cell phone Plan

Answers

I’m pretty sure it’s
-saving on insurance
-car loan
-getting good cell phone plan

Select the correct answer.
Kruger Trading Inc. buys goods on credit. In which two accounts will the company post this transaction after entering it into the journal?
OA. Goods and Cash
ОВ.
Goods and Creditors
Ос. .
Purchases and Creditors
OD
Purchases and Cash

Answers

Answer:

с. Purchases and Creditors

Explanation:

A goods account is hardly created in the general ledger. Accountants and bookkeepers use the purchases account to record goods bought by the company.  

When a business makes purchases, it can either pay cash or in credit.  Cash payments are recorded in the cash account. They reduce cash held by the business.

Credit purchases increase creditors and are recorded in the creditor's account.

What is a 401 (k) retirement plan? I NEED HELP:(

Answers

Answer:

-an employer sponsored retirement plan that allows a worker to save for retirement while deffering income taxes on the saved money or earnings until withdrawal.

Explanation:

just cause homie

A 401(k) retirement plan is a retirement plan sponsored by the employer where he or she deducts a small percentage of the gross pay of the employee.

What is the significance of the 401(k) retirement plan?

A 401(k) retirement plan can be referred to or considered as a plan where the employer contributes a fixed and a small proportion from the gross pay of the employee until the time he or she serves to the company of the employer.

An employee is free from paying any kind of taxation amount over the monies he or she has saved in a 401(k) retirement plan. However, the taxation is not a liability only until the employee makes a withdrawal.

Therefore, the significance regarding a 401(k) retirement plan has been aforementioned.

Learn more about 401(k) retirement plan here:

https://brainly.com/question/13500098

#SPJ2

coffee to
growing more
16)
16]
2 TGH are a public limited company which makes sports shoes (trainers). It makes
a variety of designs for the mass market. The mass market is for young people
who want fashionable sports shoes as well as those who play sport. The Directors
segment of customers who have a medical problem with their feet and need
recently decided to target a niche market which is for a particular market
b) Identify two examples of the different markets for TGH products.
c) Identify and explain two reasons why TGH sell to a niche market.
d) Identify and explain two advantages to TGH of segmenting the market
e) Do you think the Directors of TGH were right to target a niche market
or should they have stayed with just a mass market? Justify your answer.
specially designed shoes,
a) What is meant by a 'niche market'?
for sports shoes.
Revision checklist
In this chapter you have learned:
the role of marketing-identifying and satisfying customer needs as well as​

Answers

Answer:

Is this reading then answering questions or....

Explanation:

I dont get the question sry but I'll try to help

what are some advantages of using a Credit card the right way?

Answers

it builds your credit score

Beyond convenience, advantages of credit cards include:

Opportunity to build credit.

Earn rewards such as cash back or miles points.

Protection against credit card fraud.

Free credit score information.

No foreign transaction fees.

Increased purchasing power.

Not linked to checking or savings account.

What is the purpose of a hazard plan?


a.Search through food for pests b.Document procedures c.identify supply chain concerns or problems d.create rules and regulations

Answers

Hazard mitigation plans are prepared and adopted by communities with the primary purpose of identifying, assessing, and reducing the long-term risk to life and property from hazard events.

Sorry if this doesn't specifically answer your question, but I hope it helps :)

Other Questions
What is the definition of fourteen points? What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please! 2 3/8 x 3 3/4 divided by 2 2/3 HELP PLEASEAt Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event? A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites. B. It provided money to businesses responsible for toxic waste sites to clean up their pollutionC. It helped boost the economy among those waste sites D. It helped identify toxic waste site and move people away from them what do you understand by the term current state and define its SI unit......... help please! thank you!The ratio of cats to dogs is 8/6, which can be simplified to 4/3. The ratio of fish to birds is 20/2. Can it be simplified to 10? Why or why not? Answer in complete sentences. Its an inequality I need the work for it ik the answer Which of the following stimuli is least likely to cause an animal to vomit?A.A bacterial infection in the stomachB.Feeling cold after stepping outsideC.Drinking large amounts of water at onceD.Getting dizzy after spinning in circles do you have any song writing tips whats 43.6 rouded to the nest tenth I dont know how to do this can someone help?