Find the percentage change from
75 to 50.

Answers

Answer 1

Step-by-step explanation:

50÷75 is .6667. that means that 50 is 66.7 percent of 75.

100 minus 66.7 is 33.3. It is a 33.3 percent change

Answer 2

Answer:

-25%

Step-by-step explanation:

hope this helps!! please mark brainliest.


Related Questions

The area of a rectangular pool is (x + 17x + 72) square meters. The dimensions of the pool are the factors of this polynomial. There is a 3-meter-wide concrete walkway around the pool. Write expressions to represent the dimensions of the outside border of the walkway. (Lesson 21.1)​

Answers

Answer:

The walkway around the pool makes the entire outer dimensions (outer border)  

x+9+2x3=x+15  and  x+8+2x3

hope this helps!  could i get brainliest plz?

The expressions to represent the dimensions of the outside border of the walkway is  (x + 12) meters for the length and (x + 11) meters for the width.

Given area : [tex]x^2 + 17x + 72[/tex]

The factored form of the polynomial is:

[tex]x^2 + 17x + 72[/tex]  = [tex]x^2 + 8x+9x+72[/tex]

                      = x(x+8)+9(x + 8)

                          =(x + 9)(x + 8)

So, the dimensions of the pool are (x + 9) meters and (x + 8) meters.

The length of the walkway = 3 meters wide

So, the length is added to each side of the pool.

Dimensions of the outside border of the walkway:

Length: (x + 9) + 3 = x + 12 meters

Width: (x + 8) + 3 = x + 11 meters

Therefore, the dimensions of the outside border of the walkway are

(x + 12) meters for the length and (x + 11) meters for the width.

Learn more about polynomials here:

https://brainly.com/question/11536910

#SPJ4

In the data set {(7,7);(3,10);(5,9);(2,12);(0,1);(6,4);(4,10);(8,6)}, which point is a possible outlier?

(6,4)
(7,7)
(2,12)
(0,1)

Answers

6,4 and or 8,7 should be the answer

The possible outlier may be [tex](0,1)[/tex] as the second component is not greater than second components of the remaining pairs in comparison.

How to determine the possible outlier

In this data set, we observe that data set observes the rule that first component increases inasmuch the second component of the ordered pairs decreases. Thus, the possible outlier may be [tex](0,1)[/tex] as the second component is not greater than second components of the remaining pairs in comparison. [tex]\blacksquare[/tex]

To learn more on ordered pairs, we kindly invite to check this verified question: https://brainly.com/question/11740961

Enter the correct answer in the box
The number of cups of sports drink that can be filled from a cooler varies inversely with the capacity of each cup. If each cup holds
6 ounces, 128 cups can be filled.
Write an equation that can be used to find the number of cups, c, of sizes ounces that can be filled from the cooler.

Answers

Answer:

the equation should be c=768/s or c s=768.

Step-by-step explanation:

This situation involves inverse variation, so the equation will either take the form c=6/3 or the form cs=k.

To write a general equation for this situation, find the value of k. Use the form cs=k and the point (128,6) since the container can fill 128 cups holding 6 ounces each.

cs=k

(128)x(6)=k

768=k

Using 768 for k, the general equation is c=768/s or cs=768.

The equation for the number of cups for a specific size can be written as c = 768/x.

What is a Linear equation?

A linear equation is a equation that has degree as one.

To find the solution of n unknown quantities n number of equations with n number of variables are required.

The amount of drinks carried by each cup is 6 ounces.

And, the total number of cups are 128.

Then,the total amount of drink is 128 × 6 = 768 ounces.

Suppose the number of cups be c.

And, the size of each cup be x.

The following equation can be written for the number of cups as,

c = 768/x

Hence, the equation that describes the number of cups for the given case is c = 768/x.

To know more about Linear equation click on,

brainly.com/question/11897796

#SPJ2


A circle has a diameter of 32 units. What is the area of the circle to the nearest hundredth of a square


Answers

Answer:

804.25 units²

Step-by-step explanation:

radius = diameter / 2

Area of a circle = πr²

radius = 32/2 = 16 cm

Area = (16)²π

Area = 256π = 804.247719

Area ≈ 804.25 units²

Brainliest for correct answer

Answers

Answer:

a) b

b) d

Step-by-step explanation:

Describe what is shown in the graph below

Answers

Answer: the shorter the amount of time the higher the ball is in the air

please help________^​

Answers

Answer:

first answer

Step-by-step explanation:

It’s A !!!!!!!!!!!!!!! i

Solve for ppp. -5\left(p+\dfrac35\right) = -4−5(p+ 5 3 ​ )=−4minus, 5, left parenthesis, p, plus, start fraction, 3, divided by, 5, end fraction, right parenthesis, equals, minus, 4

Answers

Answer:

p = 1

Step-by-step explanation:

4 - 5(p + 3/5) = -4

Find P

4 - 5(p + 3/5) = -4

4 - 5p -15/5 = -4

4 - 5p - 3 = -4

-5p + 1 = -4

-5p = -4 - 1

-5p = -5

p = -5/-5

p = 1

Check:

4 - 5(p + 3/5) = -4

4 - 5(1 + 3/5) = -4

4 - 5 - 15/5 = -4

4 - 5 - 3 = -4

4 - 8 = -4

-4 = -4

Answer:

ITS HELLA 1/5 NOT 1

Step-by-step explanation:

>:(

Solve for the variable in 6/18 = x/36

Answers

Answer:

x=28.67

Step-by-step explanation:

6          x

18        36

18x      516

18          18

x=28.67

My father invests $5000 in a new bank that has an annual
interest rate of 3.8%. Find the balance
after 10 years if it is compounded yearly. Round your answer to
the nearest whole dollar.
$

Answers

$6900

$5000+3.8%=$5190

$190x10=$1900

$5000+$1900=$6900

A trader bought 20 cups of rice at 5 cups for 100 naira and sold them at 4 cups for 100naira . what was his profit

Answers

Answer:

He is making 20 naira profit for every 4 cups that he sells for 100 naira

Therefore, if he selled all this cups for 100 naira per 4 cups he made a total profit of 100 naira

Solve the equation 5(x+6)+11=25−3x

Answers

Answer:

x=-2

Step-by-step explanation:

Let's solve your equation step-by-step.

5(x+6)+11=25−3x

Step 1: Simplify both sides of the equation.

5(x+6)+11=25−3x

(5)(x)+(5)(6)+11=25+−3x(Distribute)

5x+30+11=25+−3x

(5x)+(30+11)=−3x+25(Combine Like Terms)

5x+41=−3x+25

5x+41=−3x+25

Step 2: Add 3x to both sides.

5x+41+3x=−3x+25+3x

8x+41=25

Step 3: Subtract 41 from both sides.

8x+41−41=25−41

8x=−16

Step 4: Divide both sides by 8.

8x

8

=

−16

8

55 x 32 / 32
HELPPP GIVING BRAINLIEST

Answers

Answer:

55

Step-by-step explanation:

Just multiply then divide:

55 x 32 = 1760

1760 ÷ 32 = 55

Or just easier like:

55 x 32 ÷ 32 = 55

Hopefully this helps :3 Sorry if wrong :( Plz mark brainiest if correct :D Your bootiful/handsome! Have a great day luv <3

-Bee~

Use the Pythagorean Theorem to find the missing length and then round the result to the nearest tenth a=? b = 5, c = 12 what is A​

Answers

Answer:

Approximately 10.9

Step-by-step explanation:

[tex]a^2+b^2=c^2[/tex]

Plug in b (5) and c (12)

[tex]a^2+5^2=12^2\\a^2+25=144[/tex]

Subtract 25 from both sides

[tex]a^2+25-25=144-25\\a^2=119[/tex]

Take the square root of both sides

[tex]\sqrt{a^2} =\sqrt{119}[/tex]

a = approximately 10.9

I hope this helps!

A line passes through the points (0, 3) and (10, 2). What is its equation in slope-intercept form?

Answers

Answer:

1. Find slope.

slope(m)

[tex] = \frac{y2 - y1}{x2 - x1} \\ [/tex]

[tex] \frac{2 - 3}{10 - 0} = \frac{ - 1}{10} [/tex]

2. Substitute any point. (either (0,3) or (10,2) to find the y-intercept (b)

y=mx+b

3=-1/10+b

b=31/10 or 3.1

so the final answer is

y= - 1/10 + 31/10 or y= - 0.1 + 3.1

The length of a rectangle is one inch less than three times its width. If the perimeter of the rectangle is 118 inches, find the dimensions of the rectangle.

Answers

We can set up the width a X and, from the description the length would be 3X-1. The perimeter of a rectangle is determined by 2XL + 2Xw. Plugging into the equation 2(3X-1) + 2(X) = 118. Next distribute to get 6X-2 + 2X = 118. Combine like terms to get 8X = 120. Divide by 8 to get X = 15. The width is 15. The length is 3(15)-1 or 44. 88 +30 = 118

People use water to​ cook, clean, and drink every day. An estimate of 33.9​% of the water used each day is for cooking. If a family uses 67.8 gallons of water a day for cooking​, how many gallons do they use every​ day?

Answers

Answer:

23 gallons of water

Step-by-step explanation:

People use water to​ cook, clean, and drink every day. An estimate of 33.9​% of the water used each day is for cooking. If a family uses 67.8 gallons of water a day for cooking​, how many gallons do they use every​ day?

This is calculated as:

33.9 % × 67.8 gallons of water

= 0.339 × 67.8 gallons of water

= 22.9842 gallons of water

Approximately = 23 gallons of water

Therefore, 23 gallons of water are used everyday for cooking

You buy a shirt on sale for $20. This
sale price is 20% off the original price.
How much was the original price of
the shirt?

Answers

Answer:

$25

Step-by-step explanation:

Let the original cost of the shirt be x, therefore the sale price would be the original minus the 20% of the original price x - 0.20x = $20. Solve for x: 0.8x = 20 --> x=$25

Shirt original price $25

HELP ME !!
The linear equation c = 6.5n + 1500 models cost c, in dollars, to produce n toys at a toy factory. What is the y-intercept, and what does it mean in this context?

A)The y-intercept is 6.5 and represents the number of toys produced increases by about 6.5 for each $1 increase in cost.
B)
The y-intercept is 1500 and represents the costs $1500 to run the factory if no toys are produced.
C)The y-intercept is 1500 and represents The factory can produce 1500 toys at no cost.
D)The y-intercept is 6.5 and represents the cost increases by $6.50 for each toy produced.

Answers

Answer:

B

Step-by-step explanation:

This is because 6.5n is the slope and the +1500 is the y-intercept. Remember its y=mx+b.

Answer:

B

Step-by-step explanation:

Hope this helps have a great day :)

Write the equation of a circle with center (0,−6) and radius 4 in general form.


Answers

Answer:

x^2 + (y + 6)^2 = 4^2

Step-by-step explanation:

The general form we need here is (x - h)^2 + (y - k)^2 = r^2, where (h, k) is the center and r is the radius.

If the center is at (0, -6) and the radius is 4, then the desired equation is

(x - 0)^2 + (y + 6)^2 = 4^2, or just

x^2 + (y + 6)^2 = 4^2

Please help RIGHT NOW PLEASE HELP NOW

Answers

1. it describes what the cost would be for two medium lattes and one small latte all together.

2. it would be the first one which is 2x + y = 7.15

Step-by-step explanation:

You can buy 3 CDs for $36.00. Assuming these rates are proportional, what would be the cost of 5 CDs?

Answers

Answer:

$60

Step-by-step explanation:

36 / 3 = $12 for a single CD

12 * 5 = $60 for 5 CDs

pls help! right answer = gets brainiest

Answers

Answer:

2,4 because they are hitting each other at that point

Answer:

D

Step-by-step explanation:

The solution is where the the red and blue line intersect.


need some help with model contexts with two variable expressions

Answers

Answer is
=1720 pounds
30s, 70 L

Ok, 20 points for this one

Answers

Answer:

x = 7

Step-by-step explanation:

2 angles are added to result in = 180°

therefore

180 = 97 - 3x + 69 + 5x

180 = 166 + 2x

2x = 180 - 166

2x = 14

x = 14 ÷ 2

x = 7 ✅

The value of x = 7

______________

#IndonesianPride

- kexcvi

A contest gives out prizes for first, second, and third place. First place is $500 more than double third place. Second place is $400 less than first place. All together, $1850 is given out in prizes. How much is each prize worth?

Answers

9514 1404 393

Answer:

$1000$600$250

Step-by-step explanation:

Let t represent the third-place prize value. Then the first place prize has a value of 2t+500, and the second-place prize is 2t+100. The total value of the three prizes is ...

  t +(2t+500) +(2t+100) = 1850

  5t +600 = 1850

  5t = 1250

  t = 250 . . . . . . . . . . . third place prize

  2t +500 = 1000 . . . . first place prize

  1000 -400 = 600 . . .second place prize

The prizes for 1st, 2nd, and 3rd places are $1000, $600, and $250, respectively.

an uber charges a flat fee of $15 then charges $4 per mile write an equation for the total cost of ur ride? identify the m, b, & Equation

Answers

Answer:

Step-by-step explanation:

Alex, x, saved 30 dollars and Ethan saved 1
3
more than that.
Ethan saved _______________ dollars

Answers

ethan saved 43 more dollars than alex

Brian invests £600 into his bank account.
He receives 3.2% per year compound interest.
How much will Brian have after 6 years?
Give your answer to the nearest penny where appropriate

Answers

Answer:

It will be £2520

Step-by-step explanation:

3.2=[tex] \frac{16}{5} [/tex][tex] \frac{16}{5} \times 100 = 320[/tex]320 [tex]320 \times 6 = 1920[/tex][tex]1920 + 600 = 2520[/tex]

help meeeeeeeeee T^T

Answers

Answer:

C) 120

Step-by-step explanation:

Use three times five and minus one times

you will get 12 and multiply by 10

C. 120

or a faster way to solve these is just 150 (total # of students) and multiply by the percent in decimal form which in this case would be 0.80 (because percentage is out of 100, 80% is 80/100, which is 0.80 as a decimal)

150 • 0.8 = 120!!! :)
Other Questions
4. Suki will soon turn 18 and wants to move into her own apartment in a few years. But she isworried that she won't be able to rent an apartment without any credit history. What can Suki doto start building a good credit hitary?a. Rent an apartment with a friend who already has signed a lease.b. Continue to use her debit card responsibly, being careful to not overdraw on the accountC. Close her checking account to avoid bouncing a check.d. Get and use a store credit card or major credit card and pay off amounts due each month. Please help if you dont mind! 1/3 + 1/2 and I am 5 years old Please somebody help me and solve this problem Rockys rock quarry has three different sized trucks. Each truck can hold three ba the shipping manger put three bags that each hold about 200 pounds. Find the greatest common factor of 14 and 28 What was one benefit and one drawback of faster textile production using machines?Fast please 3. How large was the Ming Dynasty compared to the Mongols? What issues might arise from this difference? Pls I need help thank you EnglishFlowers for Algernon question How is an IQ defined by the various characters (April 21)? which part in a mosque might be blocked 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA HURRY I NEED HELPP!! of sales tax is 6%, what is the final price of a Microwave oven whose list price is $110.00? What is the probability that Mary will get an "11"? Please help TIA!!!!!!!! What is the value of the expression: 2/10 5/4?1/504/108/501/2 Raymond needs to cover the entire surface area of the square based pyramid with paper what is the minimum amount of paper he will need Read the following sentence with a misplaced modifier:Sparkling in the midday sun, the birds splashed and preened in the water.Which revision places the modifier correctly?Sparkling in the midday sun, the water birds splashed and preened.Water, sparkling in the midday sun, the birds splashed and preened in it.The birds, sparkling in the midday sun, splashed and preened in the water.The birds splashed and preened in the water sparkling in the midday sun. What two numbers have a sum of 215 and a difference of 137 Steam Workshop Downloader