Choose one of the following to answer:

Option A: For those in a relationship with Christ and have made personal choices to follow Him-

In no less than 250 words, share your personal testimony as you would to a friend that doesn't yet know Jesus. A basic structure includes: what your life was like before you made the decision to follow Jesus; how you learned about who God is; why you chose to follow Jesus; how He changed your life or what He has done for you since you chose to follow Him.
Option B: For those not in a relationship with Christ-

In no less than 250 words, share where you are on your current faith journey. Some questions to help guide you (you do not have to answer these all, just to your comfort level): Do you currently follow a different religion? Do you have questions about God or life as a Christian that you need to be answered? What is holding you back from accepting Jesus or making you skeptical if the Bible is accurate and reliable? Do you need to know how you can accept God?

Answers

Answer 1

The testimony goes thus:

Before I made the decision to follow Jesus, my life was quite aimless. I was going through the motions of everyday life, but I didn't have a clear purpose or direction. I was searching for something more, but I didn't know what that something was.

It wasn't until I started attending a Christian church that I began to learn about who God is. I heard teachings about Jesus and His love for humanity, and I was struck by the depth of His sacrifice on the cross. I learned about the concept of grace and how we can be forgiven for our sins through faith in Jesus.

As I learned more about Jesus, I began to feel a pull towards Him. I realized that He offered something that I had been searching for my entire life: a sense of purpose and direction. I chose to follow Jesus because I wanted to live my life for something greater than myself.

What is personal testimony?

Since I chose to follow Jesus, He has changed my life in countless ways. I feel a sense of peace and contentment that I never had before. I know that I am loved and forgiven by God, which has given me a sense of freedom and joy. I am more patient, kind, and selfless than before. He has helped me to see the beauty in people and the world around me. He has helped me to be more loving and to be more of a help to those around me.

In conclusion, I would say that following Jesus has given my life a sense of purpose and meaning that I never had before. I am so grateful for the love and grace that He offers, and I would encourage anyone who is searching for something more to consider following Him as well.

Learn more about testimony on:

https://brainly.com/question/27836305

#SPJ1


Related Questions

what obstacles did martin luther face (protestant reformation) face and how did he deal with them? ​

Answers

Martin Luther faced several obstacles during the Protestant Reformation. One of the main obstacles was opposition from the Roman Catholic Church, which saw his teachings as a threat to its authority and doctrine. The Church excommunicated Luther and issued a writ of heresy against him.

Luther dealt with this opposition by continuing to spread his ideas through writings and sermons. He also gained support from German princes and the common people, which helped to protect him from Church authorities.

Another obstacle Luther faced was the political and religious turmoil in Germany at the time, which made it difficult for him to gain widespread acceptance of his ideas. He dealt with this by working to unite different factions within the country, and by emphasizing the importance of faith and individual conscience over the authority of the Church

Know more about Martin Luther:-

https://brainly.com/question/885736

evaluate the extent to which federal government actions contributed to united states settlement in the west from 1830 to 1890.

Answers

Federal government actions played a significant role in the settlement of the American West from 1830 to 1890 through laws and policies.

The Federal government passed several laws and policies that encouraged westward expansion and facilitated the acquisition of land from Native American tribes. The Indian Removal Act of 1830, for example, forced Native American tribes to move west of the Mississippi River, allowing for the settlement of their ancestral lands. The Homestead Act of 1862 provided free land to settlers who agreed to improve and cultivate it for at least five years. The Pacific Railroad Act of 1862 provided government subsidies to companies building a transcontinental railroad, which made it easier for settlers to travel west. The government also provided military protection and support for settlers, as well as funding for infrastructure development, such as roads and telegraph lines. These actions helped to create the conditions that allowed for the rapid settlement of the American West, and have had long-lasting impacts on the region and the country as a whole.

To learn more about Homestead Act click here:

https://brainly.com/question/18634412

#SPJ4

The given question is incorrect. The correct question is given as:

To what extent did federal government actions contribute to the settlement of the United States in the West from 1830 to 1890?

The term “on margin” means

Answers

The term "on margin" refers to the practice of purchasing securities, such as stocks, using borrowed money. When an investor buys securities on margin, they are required to put up a certain percentage of the total purchase price as collateral, while the rest is financed by the broker.

What does Buying on margin means?

When an investor buys an asset on margin, he or she borrows the balance from a bank or broker. The initial payment made to the broker for the asset—for example, 10% down and 90% financed—is referred to as buying on margin. The marginable securities in the investor's broker account serve as collateral.

This method allows investors to leverage their money and potentially earn a higher return on their investment, but it also increases the risk because the value of the securities purchased on margin can fall, leaving the investor owing more than the securities are worth.

Read more about on margin

brainly.com/question/19577457

#SPJ1

how did the changes in american society during the gilded age (1870-1900) impact life in the cities?

Answers

Answer:

Industrial expansion and population growth radically changed the face of the nation's cities. Noise, traffic jams, slums, air pollution, and sanitation and ...

Explanation:

their city

Why do you think Stalin wanted the British and Americans to invade France as soon as possible?
Check any of the boxes that apply.
0
The Soviet army was suffering terrible losses on the eastern front.
Stalin hoped to defeat the British and Americans by invading France before they were ready.
An invasion of France would draw German troops away from the eastern front
A cross-channel invasion would force the Germans to fight on two major fronts.
DONE
0

Answers

Stalin wished for a swift British and American invasion of France because (A) the Soviet army was suffering horrendous losses on the eastern front. (B) If France was invaded, German forces would be redirected from the eastern front.

What is Joseph Stalin?

From 1924 until his death in 1953, Joseph Vissarionovich Stalin, a Soviet revolutionary and political figure born in Georgia, served as the country's leader.

He was in charge as the Communist Party of the Soviet Union's general secretary (1922–1952) and the head of the Soviet Union's council of ministers (1941–1953).

Stalin wanted the British and Americans to invade France as soon as possible because (A) the Soviet army was suffering catastrophic casualties on the eastern front.

(B) German forces would be diverted from the eastern front if France was invaded.

(C) The Germans would be forced to fight on two fronts if there was a cross-Channel invasion.

Therefore, Stalin wished for a swift British and American invasion of France because (A) the Soviet army was suffering horrendous losses on the eastern front. (B) If France was invaded, German forces would be redirected from the eastern front.

Know more about Joseph Stalin here:

https://brainly.com/question/903444

#SPJ1

Correct question:

Why do you think Stalin wanted the British and Americans to invade France as soon as possible? Check any of the boxes that apply.

a. The Soviet army was suffering terrible losses on the eastern front.

b. Stalin hoped to defeat the British and Americans by invading France before they were ready.

c. An invasion of France would draw German troops away from the eastern front.

d. A cross-channel invasion would force the Germans to fight on two major fronts.

Where was the first veterinary college in Europe established?


Germany


France


Netherlands


England


Spain

Answers

Answer:

The first European veterinary college was established in Lyon, France, in 1762.

Explanation:

The first European veterinary college was established in Lyon, France, in 1762. This college, known as the École Nationale Vétérinaire de Lyon, was founded by Claude Bourgelat, a French veterinarian and philanthropist. He recognized the need for formal education and training in veterinary medicine, as the profession was largely unregulated at the time. The college was the first of its kind and served as a model for other veterinary schools established in Europe and worldwide. The school trained students in the diagnosis, treatment, and prevention of animal diseases and focused on the health of livestock, which was necessary for the country's economy. This was a significant step forward in developing veterinary medicine as a profession and improving animal health and welfare.

What percent of people in Poland are "working age"?

Answers

The term "working age" is generally defined as the age range between 15 and 64 years old. According to Eurostat, the statistical office of the European Union, as of 2020, the working age population in Poland was around 69.5%. This means that 69.5% of the population in Poland was between the ages of 15 and 64.

It is worth noting that the working age population percentage can vary depending on the country and the specific definition used. In some cases, the working age population may be defined as those between 16 and 64 years old, while in others it may be defined as those between 18 and 65 years old.

Additionally, the working age population percentage can also be affected by factors such as migration, birth rates, and life expectancy. For example, if there is a high migration of young people or a high birth rate, the working age population percentage may be higher than in a country with low migration or birth rate.

know more about Poland's:-

https://brainly.com/question/456197

Why did president jackson oppose the second bank of the united states? question 7 options: a. he believed it was inefficient and poorly managed b. he thought it was unconstitutional and favored the wealthy c. he considered it an obstacle to industrial progress and expansion d. he believed it favored the rights of states over the federal government

Answers

The second bank of the United States was opposed by President Jackson because he believed it to be unconstitutional and to privilege the wealthy. So, option B is correct.

The National Bank was opposed by Andrew Jackson because he believed it to be illegal and to have given capitalists too much economic power. The state banks could also be under the National Bank's authority. The state banks' reserves may be reduced by the national banks' demands for gold and silver, which would make their printed money less valuable. The state banks would have more reserves and be able to value their paper money higher if the national banks didn't require gold and silver. In addition, the National Bank was spending money to keep specific persons in their positions in Congress or to elect them.

To know more about National Bank

brainly.com/question/4736734

#SPJ4

how did assyria gradually rise as a threat to israel

Answers

Assyria's rising as an impressive power in the Close to East was expected in huge measure major areas of strength for to who expanded her boundaries and oppressed different countries as feeders. Assyria originally turned into a free country somewhere in the range of 1813 and 1781 B.C.

According to an Assyrian point of view, not withstanding, the intrusion of Israel was essential for a lot more extensive military hostility intended to lay out political and financial predominance over the courses across the Syrian Desert to the harbors of the Mediterranean.

The Assyrian domain imploded under the attack of Babylonians from southern Mesopotamia and Medes, newbies who were to lay out a realm in Iran.

Learn more about Assyria:

https://brainly.com/question/28323879

#SPJ4

Review the list of presidential roles you created in item 1. Provide at least one example in which one or more of these roles could be at odds with one or more of his or her other roles. What are the implications of this?




here is the list of roles :



1) Chief Executive


2) Commander in Chief


3) Chief Diplomat


4) Legislative Leader


5) Head of State


6) Party Leader


7) Judicial participant

Answers

Each of these responsibilities falls on the President at the same time.

Failure to carry out one task on occasion can result in failure in another.

For instance, the Watergate incident led to President Richard Nixon's forced resignation from office in 1974. His electorate was dissatisfied with the manner he decided to carry out his responsibilities as party leader and Judicial participant.

The president continues to serve as the party's political leader. Like other institutions, this one has a plan and goals of its own. For the vast majority of Americans, these goals might not necessarily be advantageous. However, since the president must also address the allegations made by his party members, there is a chance that he would become embroiled in a conflict of interest.

To know more about the President:

brainly.com/question/12116925

#SPJ4

Question 1 Match the statement on the left with Jackson, Young or both. first African American mayor of Atlanta brought development to Atlanta expanded Georgia's economy expanded Hartsfield Atlanta International Airport co-chair of the Atlanta Committee for the Olympic Games first African American elected to represent Georgia in Congress since Reconstruction recruited African Americans to join the police force appointed as Ambassador to the United Nations by Jimmy Carter [Choose ] [Choose ] [Choose ] [Choose] [Choose] [Choose ] [Choose ] [Choose] 10 pts​

Answers

The statements matched with the related political dignitaries are:

Maynard Jackson - first African American mayor of Atlanta, brought development to Atlanta, expanded Hartsfield Atlanta International Airport, co-chair of the Atlanta Committee for the Olympic GamesAndrew Young - first African American elected to represent Georgia in Congress since Reconstruction, appointed as Ambassador to the United Nations by Jimmy Carter, recruited African Americans to join the police forceBoth - expanded Georgia's economy.

Who is Maynard Jackson?

Maynard Holbrook Jackson Jr. was a Georgia politician and attorney. He was elected as the first black mayor of Atlanta, Georgia, and of any large city in the South in 1973, at the age of 35, as a member of the Democratic Party.

Jackson is most recognized for expanding chances for African Americans to do business with the City of Atlanta, particularly through the construction of Hartsfield Airport—now renamed Hartsfield-Jackson Airport.

Learn mroe about Jimmy Carter:
https://brainly.com/question/23064245
#SPJ1

Many countries offer ________
to people suffering from drought, famine, or war. __________
pursue this aspect of foreign aid to achieve the goal of __________
.
first blank sanctions , trade deals , dipolmacy, humanitary aid
second blank the armed forces, international goverment organzations excutive departments, inteligance agencies .
third blank stability around the world , econmic advancement , denuclearazation of countries , negotiations with other countries .

Answers

Answer:

Many countries offer humanitarian aid

to people suffering from drought, famine, or war. international government organizations pursue this aspect of foreign aid to achieve the goal of stability around the world

Explanation:

1.  humanitarian aid

2.  international government organizations

3.stability around the world

Many countries offer humanitary aid to people suffering from drought, famine, or war. International government organizations and executive departments pursue this aspect of foreign aid to achieve the goal of stability around the world.

How does expansion and innovation effect a nation’s identity? Give 2 pieces of textual evidence

Answers

Answer:

Expansion and innovation can have a significant impact on a nation's identity, as these processes can bring about changes in culture, economy, and society.

In the book "The Unbound Prometheus" by David Landes, he states "The Industrial Revolution was a time of tremendous expansion and innovation, and it brought about significant changes in the way people lived and worked, as well as in the way that nations perceived themselves and interacted with one another. The increased economic activity, technological advancements, and societal transformations that resulted from this period had a profound effect on the identity of the nations that experienced it."

In the article "Identity, Innovation and Economic Growth" by John Cantwell, he writes "Innovation and expansion can lead to the creation of new industries and markets, which can in turn change a nation's economic structure and its role in the global economy. This can shift the perception of the nation's identity, both internally and externally, as the country's image, reputation and competitiveness change as a result of these activities."

Explanation:

Paul's second Epistle to Timothy was written around A.D:

59-62
50-53
67-70
60-63
63-67

Answers

Paul's second Epistle to Timothy was written around A.D:63-67

What was Paul's second Epistle?

According to the Guide to the Scriptures, "Pauline Epistles," scriptures.lds.org, Paul's Second Epistle to Timothy was most likely written between A.D. 64 and 65. The letter was written by Paul during his second Roman prison sentence, just before he was crucified (see Bible Dictionary, "Pauline Epistles").

a.d. 64–67. Following a fourth missionary voyage that is not mentioned in Acts, Paul most likely composed 2 Timothy while serving a second prison sentence in Rome. Paul, who was at Ephesus at the time, sent Timothy this "farewell" letter in anticipation of his impending death. In it, Paul urged Timothy to maintain his resolve and invited him to come for one more visit.

Therefore, option D is correct.

Learn more about Timothy at:

https://brainly.com/question/4443914

#SPJ1

what was one reason that african slavery replaced indentured servitude as the primary labor source in the late seventeenth century in the chesapeake colonies?

Answers

As the economy improved in England, people were less likely to come to the colonies  was one reason that african slavery replaced indentured servitude as the primary labor source in the late seventeenth century in the chesapeake colonies.

According to Galenson (1984), changes in the availability and demand of labour in England and the trans-Atlantic slave trade led to the switch from indentured European labour to enslaved African labour. However, when England's economy developed in the 1660s, fewer Europeans were eager to accept indentures (contracts) to work in colonies.

For cheap labour and higher profits, plantation owners in the Chesapeake started using race-based slavery. Only slaves were capable of doing the tasks needed on plantations. Salvation was independent of church attendance. By the time "An act touching Servants and Slaves" was passed in 1705, slavery had permeated every aspect of Virginia culture and had all but replaced indentured servitude as the main source of bound labour in the colony.

For such more questions on  chesapeake colonies:

brainly.com/question/5231025

#SPJ4

what are the 4 values that would be reflected in the Democratic Party

Answers

The following principles were chosen: equality, truth, diversity, popular sovereignty, life, liberty, the pursuit of happiness, justice, the common good, and patriotism.

Values of the Democratic Party?

Democrats think we can and should improve life for families across our country, whether it be through equal pay, labor rights, environmental protection, or taking on special interests.

Fairness, justice, and equality for everyone by defending all Americans who are in the middle class or trying to get there.

Democratic platforms aim to advance social programs, labor unions, consumer protection, workplace safety regulation, equality of opportunity, disability rights, racial equity, environmental pollution controls, and criminal justice reform.

The values that were determined are as follows: life, liberty, happiness pursuit, justice, the common good, equality, truth, diversity, popular sovereignty, and patriotism.

Therefore, the following principles were chosen: equality, truth, diversity, popular sovereignty, life, liberty, the pursuit of happiness, justice, the common good, and patriotism.

Know more about Democratic Party here:

https://brainly.com/question/710925

#SPJ1

The parents have to carry the two things that take the most force to lift. The children have to carry the things that take the least force to list. Which two items should the parents carry? A umbrella and cooler B C D towels and umbrella books and chair books and cooler​

Answers

Parents must carry the two items that require the most force to lift, while the children must carry the items that require the least force to list, so the umbrella and cooler must be carried by the parents in Option A.

What is the significance of the umbrella?

The umbrella is the item that will keep the rain away and protect the person from getting wet in the rainy season and it also helps people avoid getting colds and flu during the rainy season.

As a result, the parents must carry the two items that require the most force to lift, while the children must carry the items that require the least force to list, so the umbrella and cooler must be carried by the parents in Option A.

Learn more about the umbrella here.

https://brainly.com/question/28963084

#SPJ1

And please create a three paragraph essay that supports this

Answers

In writing an essay you must consider the structure of the essay, Hence, the structure of the essay should be considered;

The Introduction The body'The conclusion

What is a three-paragraph essay?

Generally, Federalists, such as Alexander Hamilton and James Madison, believed in a strong central government that could promote economic growth and stability. They supported the establishment of a national bank and a system of tariffs to fund the government. They also believed in a strong military to protect the country's interests.

Antifederalists, such as Thomas Jefferson and Patrick Henry, believed in limiting the power of the central government and preserving the rights of the states. They were particularly worried about the potential for tyranny if the government became too powerful. They wanted to protect individual rights and liberties and opposed the idea of a national bank and a standing army.

In terms of evidence, Federalists argued in the Federalist Papers, a series of essays written by Alexander Hamilton, James Madison, and John Jay, that a strong central government was necessary for the country's stability and prosperity. The Federalist Papers presented the Federalist's point of view on the proposed Constitution and its ratification.

On the other hand, Antifederalists wrote a series of essays and pamphlets, known as the Anti-Federalist Papers, in which they expressed their concerns about the Constitution and the potential dangers of a strong central government. These essays and pamphlets argued that the Constitution would lead to the erosion of individual rights and the consolidation of power in the hands of a few.

In conclusion, both Federalists and Antifederalists articulated strong visions for the country, but they had different ideas about how to achieve those goals. Federalists favored a strong central government and economic growth, while Antifederalists favored protecting individual rights and liberties and limiting the power of the central government.

Read more about essay

https://brainly.com/question/7196877

#SPJ1

what were the factors that enabled the old norse and saxon languages to mix, rather than one replacing the other?

Answers

Social and political factors enabled the Old Norse and Saxon languages to mix, rather than one replacing the other.

Social factors such as intermarriage, trade and cultural exchange, and the presence of mixed communities enabled the Old Norse and Saxon languages to mix and influence each other.

Political factors such as the absence of a strong central government or dominant ruling class also allowed for the coexistence and mixing of the two languages.

Additionally, the fact that both Old Norse and Saxon were Germanic languages made it easier for them to blend and form a new language, now known as Old English.

The linguistic and cultural proximity of the two groups helped the languages to blend and influenced each other, rather than one replacing the other. Furthermore, the lack of central power and the presence of mixed communities helped to preserve both languages and allowed them to coexist.

For more questions like Saxon click the link below:

https://brainly.com/question/12642007

#SPJ4

Which sentence best describes how the process of westward expansion affected American political culture?

A.
The need for labor led to the abolition of slavery and increased respect for personal liberty.

B.
The concept of expansion led to an accepting culture, and also inspired involvement in international politics.

C.
The culture of settlers led to a respect for self-reliance, but also led to discrimination against Native Americans.

D.
The addition of new states led to a respect for states’ rights, but also led to a decrease in the power of the urban majority.

Answers

Answer: C

Explanation:

Before the passage of the Fifteenth Amendment, which gave the tribes equal rights with Americans in 1870, Native Americans went through genocide as a result of American interference with their living conditions, which forced them to move west and wiped out many tribes in the process.

Read the Preamble to the Constitution, and answer the question that follows.

We the People of the United States, in Order to form a more perfect Union, establish Justice, insure domestic Tranquility, provide for the common defence, promote the general Welfare, and secure the Blessings of Liberty to ourselves and our Posterity, do ordain and establish this Constitution for the United States of America.

Which phrase from the Preamble shows that the Constitution aims to uphold US laws?

A. form a more Perfect Union
B. insure domestic Tranquility
C. secure the Blessings of Liberty
D. we the people

Answers

B. Insure domestic tranquility

written grant of authority from the king to establish a colony

Answers

A written grant of authority from the king to establish a colony is a charter

A charter is regarded of as a written gift that has been granted by a nation's sovereign or legislative power. It is a formal, documented gift of power from a ruler or government that often includes land or other rights necessary to create a colony or other settlement. A town, city, university, or other entity may receive certain rights under a charter.

When the king previously granted proprietors or a settlement company exclusive authority over the management of land, colonial charters were deemed valid. For example, In various cities such as in America and other colonial regions of the world, charters were frequently used to create settlements and establish the legal rights and privileges of the residents.

Read more about charter on:

https://brainly.com/question/14544849

#SPJ4

No matter the cost, Japan's own security and economic survival had to be considered ahead of Asian values.
Unless Japan became more powerful, there was no way to save East Asia from the west. Japan could only be made powerful through the economic exploitation of its neighbors.
-Document 8: William Beasley,
Japanese Imperialism,
1987
Paraphrase this passage from Document 8.

Answers

The paraphrased excerpt from William Beasley document is:

Japan's imperialism was justified as a way to protect East Asia from the West. The idea was that only by taking advantage of its neighbors, could Japan become economically powerful. And this economic power, along with safety, became very important to the country, more so than maintaining traditional Asian values. Because it was considered so important, any action was justified in order to achieve it.

What was Japan's imperialism all about?

Japanese imperialism was fueled by industrialization, which pushed for overseas expansion and foreign market openings, as well as domestic politics and international prestige.

It was also fueled by a strong sense of ideological mission and racial superiority. These ideas were encapsulated in a term that was popular at the time but is now rarely heard: Pan-Asianism.

Read more about Japan's imperialism

brainly.com/question/805998

#SPJ1

hwhat did luther post on the door of the castle church in wittenburg? give the day, month, and year in which this event took place

Answers

Martin Luther posted his Ninety-five Theses on the door of the castle church in Wittenberg. This event occur took place in Wittenberg, Germany, on October 31, 1517.

Martin Luther was a theologian, hymnwriter, Augustinian friar, and German priest. Martin Luther is seminal figure of the Protestant Reformation who gave his name to Lutheranism and was ordained to the priesthood in 1507.

The Ninety-five Theses or Disputation on the Power and Efficacy of Indulgences generally described as a list of propositions for an academic disputation written on October 31, 1517 by Martin Luther, professor of moral theology at the University of Wittenberg, at the time controlled by the Electorate of Saxony.

Here you can learn more about The Ninety-five Theses on brainly.com/question/24190586

#SPJ4

describe the scientific revolution. why did it begin? who were some of the notable thinkers responsible for this revolution? was there widespread acceptance of their ideas?

Answers

The ordinary public initially read the works of the Greco-Roman period. Thomas Kepler and Isaac Newton. Some people were criticised and sacked.

Niklas Koppernik, also known as Nikolaus Kopernikus in German, was a Renaissance polymath who was active as an astronomer, mathematician, and Catholic canon. Instead of the Earth, he built a cosmic model that was centred on the Sun. Aristarchus of Samos, an early Greek astronomer, undoubtedly came up with his hypothesis prior to Copernicus, who most likely did it some eighteen centuries earlier.

A major turning point in the history of science occurred when Copernicus published his model in his book De revolutionibus orbium coelestium soon before his death in 1543. This was because it started the Copernican Revolution and significantly influenced the Scientific Revolution.

Learn more about scientific revolution at

https://brainly.com/question/594540?referrer=searchResults

#SPJ4

fort wood and the statue of liberty are declared a national monument.

Answers

A Presidential Proclamation issued on October 15, 1924, established Fort Wood as a National Monument with the Statue of Liberty within it as its perimeter. The National Park Service assumed responsibility for the maintenance and management of the National Monument in 1933.

In 1924, President Calvin Coolidge utilized the Antiquities Act to grant the statue national monument status. President Franklin D. Roosevelt enlarged the monument to include the entirety of Bedloe's Island by proclamation 2250 in 1937. Liberty Island was then given its current designation by an act of Congress in 1956. The statue was placed inside Fort Wood, which was constructed there during the War of 1812, in 1885–1886.

To know more about Statue of Liberty:

https://brainly.com/question/7692374

#SPJ4

a government in which the president is directly elected by the people

Answers

In Presidential form of Government the president is directly elected by the people.

An executive branch that is separate from the legislative branch is headed by the president in a presidential system, sometimes referred to as a single executive system.

Few other democracies, including Argentina, Brazil, Mexico, and the Philippines, have adopted the presidential system, which was invented and is best known for in the United States.

The Question is-

In what type of government the president is directly elected by the people?

To know more about Government, click here:

https://brainly.com/question/16940043

#SPJ4

How did the post-World War II Red Scare compare and contrast with the one that
followed World War I?

Answers

Answer: Many state and local governments, universities, businesses, unions, churches, and private groups also began efforts to find Communists. The University of California required its faculty to take loyalty oaths and fired 157 who refused. Many Catholic groups became anti-Communist and urged members to identify Communists within the Church. The Taft-Hartley Act of 1947 required union leaders to take oaths saying that they were not Communists. Many union leaders did not object. Instead, they launched efforts to purge their own organizations, eventually expelling 11 unions that refused to remove Communist leaders.

Explanation:

The map below shows a graphic representation of an important movement in the 16th - 18th centuries.

A map of 3 arrows in a triangle labeled A, B, and C. Arrow A points from the Caribbean to Europe. Arrow B points from Europe to Africa. Arrow C points from Africa to the Caribbean.



What do the arrows show?

the three primary trade winds that helped ships travel in the 1500s
the movement of goods, money, and enslaved people that made up Triangular Trade
the movement of silver during the Commercial Revolution
the three primary routes for commercial trade between Hispaniola and the Old World

Answers

Answer: d

Explanation:

Describe at least three of the things that helped cause the fighting of the Vivek war

Answers

A few of the factors that led to the war were British attempts to stifle American trade, the Royal Navy's recruitment of American seamen, and American territorial ambitions.

What is American territorial ambitions?In order to provide the United States more leeway in dealing with other countries on the North American continent and to solidify the power of the fledgling republic, Jefferson's foreign policy was to increase American territory westward. It necessitated enhancing one's military prowess and honing diplomatic cunning.Mining possibilities and the gold rush (silver in Nevada) the chance to work as a "cowboy," to be involved in the cattle business Railroad-related advantages include quicker travel to the West and increased supply options. under the Homestead Act, a low-cost option for land ownership.The populace in the United States continued to favour republican rule and further territory expansion after the 1840s territorial expansions.

To learn more about American territorial ambitions refer to:

https://brainly.com/question/19367926

#SPJ1

Other Questions
Becky had net sales (all on account) in 2017 of $820000. At December 31, 2017, before adjusting entries, the balances in selected accounts were: accounts receivable $1000000 debit, and allowance for doubtful accounts $2120 debit. Becky estimates that 2% of its accounts receivable will prove to be uncollectible. What is the net realizable value of the receivables reported on the financial statements at December 31, 2017 there are 10 employees in a particular division of a company. their salaries have a mean of $70,000, a median of $55,000, and a standard de?viation of $60,000. the largest number on the list is $ 100,000. by accident, this number is changed to $ 1,000,000. which nims structure develops recommends and executes public information Using y = 6 - 2x, plot the ordered pairs from the table. Then graph the function represented by the ordered pairs and tell whether the function is linear or nonlinear. Part 1 out of 3 Complete the table. Input, x Output, y Check -1 3 Next a client who is taking an oral hypoglycemic daily for type 2 diabetes develops an infection with anorexia. which advice will the nurse provide to the client? a solution is prepared at that is initially in dimethylamine , a weak base with , and in dimethylammonium bromide . calculate the ph of the solution. round your answer to decimal places. find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange. according to the proponents of the quantity theory of money, can a change in the money supply m cause a change in the level of real gross domestic product y? this graph shows merchandise export data for the years 2010 through 2012. a graph titled total merchandise exports from 2010 to 2012 has year on the x-axis and exports in trillions of u s dollars on the y-axis, from 0 to 2.5 in increments of 0.5. a line representing united notes exports is slightly lower than a line representing china exports. which statement most accurately describes the information presented on the graph? during the 21st century, the complexity of the challenges posed by disruptive, digital technologies and accelerating rates of change has encouraged companies to: In order to maintain compliance with standard precautions, a medical assistant should recognize that which of the following tasks requires the use of gloves despite the absence of any visible blood?a) Administering a nebulizer treatmentb) Performing a visual acuity testc) Obtaining a tympanic readingd) Removing a cyst