Below, a pre-mRNA is shown and the complete, edited mRNA is shown. a) in the complete mRNA, use a green pen or highlighter to highlight the methyl G cap. b) In the complete mRNA, use a red pen or highlighter to highlight the poly A tail. c) In both the pre-mRNA and complete mRNA, highlight each exon with diffeent colors, to show the pieces of pre m-RNA that are in both. Heres the pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU. Heres the complete edited mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

Below, A Pre-mRNA Is Shown And The Complete, Edited MRNA Is Shown. A) In The Complete MRNA, Use A Green

Answers

Answer 1

a)Highlight the first nucleotide in green. b) Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red. c) Three exons in pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC".

What is mRNA?

Messenger ribonucleic acid is single-stranded molecule of RNA that corresponds to genetic sequence of gene.

a) Methyl G cap is added to the 5' end of the mRNA, so in the complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA",  first nucleotide is methylated guanine (methyl G) cap. Highlight the first nucleotide in green.

b) The poly A tail is added to the 3' end of mRNA, so in complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA", last several nucleotides are all adenine (A) nucleotides that make up the poly A tail. Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red.

c) Exons are coding sequences of a gene that are kept and joined together after splicing, while introns are non-coding sequences that are removed. Based on given sequences, we can identify three exons in the pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC". In complete mRNA, these three exons are joined together, and intron sequence "CUAUU" is removed.

To highlight exons, we can use three different colors. Let's use blue for  first exon "AUG", orange for second exon "ACCCGGGACGCGCGA", and pink for third exon "UGCCC".

In pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU

Highlighted with different colors for exons:

AUGAACCCGGGACGCGCGAUGCCCUAUU

^^^^ blue ^^ orange ^^^^ pink ^^^^

In complete mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

Highlighted with different colors for exons:

GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

^^^^ blue ^^ orange ^^^^ pink ^^^^

To know more about mRNA, refer

https://brainly.com/question/24885193

#SPJ1


Related Questions

Which of the following would result in fraternal twins who don’t have identical DNA 


A) two sperms fertilizing two different eggs that are released in the same cycle

B) one sperm fertilizing, a single egg that splits into two embryos

C) two sperm fertilizing a single egg

D) one sperm fertilizing a single egg

Answers

The following would result in fraternal twins who don’t have identical DNA : A) Two sperms fertilizing two different eggs that are released in same cycle can result in fraternal twins who don’t have identical DNA.

What are fraternal twins?

Fraternal twins are also known as dizygotic twins. It occurs when two eggs are released during the same ovulation cycle and are fertilized by two different sperm. Each zygote will have its own unique genetic material, resulting in fraternal twins who are not identical and may have different physical characteristics and traits.

Option B describes the process of identical twins, where single fertilized egg splits into two embryos, resulting in two individuals with same DNA.

Option C is not possible as single egg can only be fertilized by one sperm.

Option D describes the normal process of conception and will result in single individual with its own unique genetic material.

To know more about fraternal twins, refer

https://brainly.com/question/986349

#SPJ1

4. Earth's rock layers include the upper mantle, the lower mantle, the crust, and the Moho.
A. Create a diagram that labels each of the four layers listed above. (4 points)
B. What is one characteristic of each layer? (4 points)

Answers

part a. The diagram showing the upper mantle, the lower mantle, the crust, and the Moho is attached.

part b.

The characteristics include:

for the Crust:

The crust  is relatively thin compared to the other layers.

for the Lower Mantle:

It is located below the upper mantle.

for the Moho :

It marks the boundary between the crust and the mantle.

for the upper Mantle:

It Lies beneath the crust.

What are the rock's layers?

The science of strata, stratigraphy, deals with all of the features of layered rocks and includes the study of how these rocks connect to time. Rock layers are also known as strata (the plural version of the Latin word stratum.

The rock layers in order are : Cambrian, Ordovician, Silurian, Devonian, Carboniferous, (Mississippian and Pennsylvanian), Permian, Triassic, Jurassic, Cretaceous, Tertiary, and Quaternary.

Learn more about rock layers at:

https://brainly.com/question/25846908

#SPJ1

if enough individuals in a popularization have effective adaptions and survive what happens to the population. ​

Answers

if enough individuals in a popularization have effective adaptions and survive whole may undergo a process of natural selection.

What is natural selection?

Natural selection is a mechanism of evolution that favors individuals with traits that increase their likelihood of survival and reproduction. As a result, these individuals are more likely to pass on their advantageous traits to their offspring, and over time, these traits can become more common in the population.

If a population hasthat allow its members to survive better in their environment, then those members are more likely to reproduce and pass on their genes to the next generation. Over time, the frequency of these advantageous traits may increase in the population, while the frequency of less advantageous traits may decrease.

Read more on natural selection here"https://brainly.com/question/15577096

#SPJ1

Question You borrow $3200 to buy new kitchen appliances. The simple interest rate is 5%. You pay the loan off after 4 years. What is the total amount you paid for the loan?

Answers

Answer:

The total amount paid for the loan can be calculated as follows:

Total amount = Principal + Interest

Where Principal is the amount borrowed, and Interest is the additional amount charged for borrowing the money.

Given:

Principal (P) = $3200

Interest rate (r) = 5% = 0.05 (as a decimal)

Time (t) = 4 years

Using the simple interest formula:

Interest = P × r × t

Interest = $3200 × 0.05 × 4

Interest = $640

Therefore, the total amount paid for the loan is:

Total amount = $3200 + $640

Total amount = $3840

Hence, the total amount paid for the loan is $3840.

Explanation:

The active site of an enzyme is complementary to :

A. One type of product molecule

B. All types if product molecules

C. One type of substrate molecule

D. All types if substrate molecule

Answers

Answer:

Option C is correct. The active site of an enzyme is a specific region that is complementary to a specific substrate molecule. This means that the active site has a specific shape that only fits with the shape of a particular substrate molecule. Once the substrate molecule binds to the active site, the enzyme can catalyze the reaction to form the product(s).

8. The climate and vegetation of Earth changed from the Mesozoic era to the Cenozoic era (current
day).
A. What are two ways the climate has changed since the Mesozoic? (6 points)
B. What is one way vegetation has changed since the Mesozoic? (3 points)

Answers

Answer:

A. Two ways the climate has changed since the Mesozoic are:

Cooling: The average temperature of Earth has decreased significantly since the Mesozoic era, particularly during the Cenozoic era. This cooling was caused by a decrease in atmospheric carbon dioxide levels, changes in ocean circulation patterns, and other factors.

Increased variability: The climate has become more variable and unpredictable since the Mesozoic era, with more frequent extreme weather events such as droughts, floods, and hurricanes. This may be due to changes in ocean and atmospheric circulation patterns, as well as human-induced climate change.

B. One way vegetation has changed since the Mesozoic is:

Evolution of flowering plants: During the Mesozoic era, the dominant plant species were gymnosperms such as conifers and ferns. However, during the Cenozoic era, flowering plants (angiosperms) became the dominant plant species. This change in vegetation may have been driven by the evolution of new pollination strategies and adaptations to changing climate conditions.

Explanation:

How does the particle arrangement and movement change? How does the particles behave in a liquid and how that changes when it becomes a gas.

Answers

Answer:

The particles in a liquid are loosely packed and occupies and moves much more freely than particles in solids, and when liquid changes to gas the particles becomes even more free. The arrangement of particles in both gases is more loose and free than in solids. There is an irregular arrangement that allows for more movement between particles.

what is one reason why seasons on the outer planets are different than the seasons experienced on the inner planets?

Answers

The seasons on the outer planets are distinct from those on the inner planets because of the longer orbital periods and greater axial tilts of the outer planets.

What is outer planets and inner planets?

Minor planets including Mars, Earth, Venus, and Mercury are regarded as inner planets. Mercury is believed to be the smallest inner planet, alongside Earth getting the biggest. The vastly larger distant planets, such as Jupiter, Saturn, Uranus, and Neptune, are the opposite.

What means outer planet?

Any planet of our Solar System whose trajectory lies outside the asteroid belt, such as Jupiter, Saturn, Uranus, or Neptune, is referred to as an outer planet (plural outer worlds) in astronomy.

To know more about Outer planet visit :

https://brainly.com/question/23886991

#SPJ1

2. In peas, gray seed color is dominant to white. In the following experiments, parents
with known phenotypes but unknown genotypes produced the listed progeny
Parents.
a. gray x white
b. gray x gray
c. white x white
d. gray x white
e. gray x gray
Gray
82
118
0
74
90
Progeny
White
78
39
50
0
o
Using the letter G for the gray gene and g for white, give the most probable genotype
of each parent.

Answers

The most probable genotype of each parent will be:Parent 1: Gg × ggParent 2: Gg × GgParent 3: gg × ggParent 4: Gg × ggParent 5: Gg × Gg

As per the given scenario, in peas, gray seed color is dominant to white. In the experiments listed, the parents with known phenotypes but unknown genotypes produced the progeny given below. Parents:a. Gray x whiteb. Gray x grayc.

White x whited. Gray x whitee. Gray x grayThe progeny are given as below:Gray: 82, 118, 0, 74, 90White:

78, 39, 50, 0, oThe most probable genotype of each parent would be:

Parent 1 (a)If the gray seed color is dominant to white seed color, the gray parent could be homozygous dominant (GG) or heterozygous (Gg), and the white parent could be homozygous recessive (gg). Hence, the most probable genotype of gray would be Gg (heterozygous) and that of white would be gg (homozygous recessive).

Parent 2 (b)In case both parents are gray, we can assume that both parents are either homozygous dominant (GG) or heterozygous (Gg). Hence, the most probable genotype of both parents would be Gg (heterozygous).

Parent 3 (c)In case both parents are white, we can assume that both parents are homozygous recessive (gg). Hence, the most probable genotype of both parents would be gg (homozygous recessive).

Parent 4 (d)If the gray seed color is dominant to white seed color, the gray parent could be homozygous dominant (GG) or heterozygous (Gg), and the white parent could be homozygous recessive (gg).

Hence, the most probable genotype of the gray parent would be Gg (heterozygous) and that of the white parent would be gg (homozygous recessive).

Parent 5 (e)In case both parents are gray, we can assume that both parents are either homozygous dominant (GG) or heterozygous (Gg). Hence, the most probable genotype of both parents would be Gg (heterozygous).

To learn more about : parent

https://brainly.com/question/26152941

#SPJ11

Which idea did Lamarck propose that was rejected by his fellow scientists?

Fossils show that behaviors of ancient species.

Organisms evolve by acquiring behaviors.

Acquired traits can be passed to offspring.

Giraffes have large gene pools than most animals.

Answers

Answer:

The idea proposed by Lamarck that was rejected by his fellow scientists is "Acquired traits can be passed to offspring."

Explanation:

Lamarck believed that organisms could pass on traits they acquired during their lifetime to their offspring, a theory known as the inheritance of acquired characteristics. However, this idea has been widely discredited by the scientific community since it does not align with the principles of genetics and heredity. The traits that are passed down to offspring are determined by genetic information passed on through the reproductive cells, not by the environment or lifestyle of the parent.

If an area has a biodiversity, it is therefore stable and therefore likely to survive changes.

Answers

Biodiversity may contribute to ecosystem stability, but it alone does not guarantee it. Other factors and human activities can affect ecosystem stability.

What is biology . Define it .

Answers

Answer: the study of living organisms, divided into many specialized fields that cover their morphology, physiology, anatomy, behavior, origin, and distribution.

Explanation: The simplest definition of Biology

The sub-tropical climate zone receives rain throughout the year. The summer season (longer daily sunshine hours) lasts longer than the winter season. It is warm in the summer and it cools down a bit during the winter. Which two cities are in the subtropical climate zone? Its science so.. 50 POINTS!!!!!!!!!!!!!!1

A. Kiruna and Johannesburg

B. Sydney and Vancouver

C. Vancouver and Kiruna

D. Johannesburg and Sydney

Answers

Johannesburg and Sydney are the only two possibilities that have a subtropical climate.

What is the subtropical zone's climate?

A climatic zone characterized by hot, humid summers and cold to mild winters is known as a humid subtropical climate. These climates are often found poleward of nearby tropical climates on the southeast side of every continent (apart from Antarctica). They are typically found between latitudes 25° and 40°.

What do tropical climate and subtropical climate mean?

One of the many zones on Earth is known as the "tropics," which are the areas around the equator between the tropics of cancer in the north and the tropics of capricorn in the south. each hemisphere.

To know more about subtropical climate visit:-

https://brainly.com/question/3601081

#SPJ1

Armadillos give birth to identical quadruplets. A zoo with a healthy population of armadillos gives three to other zoos and retains the fourth. Researchers collect data on each armadillo and find that trait differences develop. What are the likely influences of genetic and environmental factors in these differences? (1 point)

Variations are largely due to genetic factors.

Variations are due to factors besides genetic or environmental.

Variations are largely due to environmental factors.

Variations are due to genetic and environmental factors.

Answers

Contrary to popular belief, which holds that genes are "cast in stone," research shows that initial encounters can affect how genes are activated and inactivated, as well as whether or whether they're expressed at all.

How do genes work?

genetic material that is transferred from parent to kid. The chromosomes with in nucleus of cells have precise sites where genes are ordered sequentially on DNA sequences.

Which genes are examples?

From one child to the next, our genes transmit information. The reason the child has white highlights resembling their mother and their sibling gets brown hair unlike their father, for instance, is genetic. Also, genes influence both the gender of newborns and why some diseases run in families.

To know more about genes visit:

https://brainly.com/question/8832859

#SPJ1

What is a drought treatment?

Answers

A drought treatment refers to a collection of actions or steps taken to lessen the effects of drought on a specific ecosystem, community, or crops.

What is drought treatment?

A drought treatment refers to a set of actions or measures taken to mitigate the effects of drought on a particular ecosystem, community, or crop.

The goal of drought treatment is to minimize the negative impacts of water scarcity and help the affected system or population cope with reduced water availability.

Drought treatments can take different forms depending on the context and severity of the drought. Some common drought treatments include:

Water conservation measuresIrrigationSoil managementCrop selectionEmergency water supply

Learn more about drought at: https://brainly.com/question/11949149

#SPJ1

how are mutation and sexual reproduction involved in creating and maintaining variation in a population? answer in simple terms

Answers

Answer:

Mutation and sexual reproduction are the two main ways that variation is created and maintained in a population. Mutations are random changes in the genetic code of an individual, which can lead to new traits that were not present before. Sexual reproduction involves the combination of genetic material from two individuals, which can create unique offspring with different traits than either parent. These two processes work together to increase the genetic diversity within a population, which is important for adapting to changes in the environment and for the survival of the species over time.

Explanation:

In sexual reproduction, gametes receive a random assortment of genetic information from their parents, which creates unique genetic combinations in the offspring.


These new genetic variations can result in new traits, some of which may be beneficial, harmful, or neutral. Natural selection can effect these traits, causing the amount of beneficial traits to increase in the population, with the opposite happening for harmful traits.

Mutations in sexual reproduction are important for creating and maintaining genetic variation in a population, otherwise evolution would not occur.

Observing How Plates Move
How slowly do plates move? Use the Sim to measure how far plates move from each other over time
and use your measurements to calculate the rate of plate motion.
1. Open the Plate Motion Sim.
2.
Go to Region 2 of the Sim.
3.
Add a GPS marker to each plate as close as possible to each other and to the plate boundary.
4. Press SET BOUNDARY and select Divergent as the plate boundary type. Then press RUN.
5. During the run, press Pause approximately every 50 million years. Record the time in the first
column of the table below. Observe the distance between the two pins by pressing on either pin
and reading the distance to the other and then record that number in the Distance column. You
can press the Reset button in the top right corner to replay the Sim.
6. Calculate the rate for each pair of distances and times by dividing the distance by the time.
Record those numbers in the Rate column.
Fill out the data table below. using evidence from the Sim.
Time (millions of years)
Distance (km)
Rate (km per million years)

Answers

Answer: Current plate movement can be tracked directly by means of ground-based or space-based geodetic measurements; geodesy is the science of the size and shape of the Earth. Ground-based measurements are taken with conventional but very precise ground-surveying techniques, using laser-electronic instruments. Sep 15, 2014

Explanation: Earth's land masses move toward and away from each other at an average rate of about 1.5 centimeters (0.6 inches) a year. That's about the rate that human toenails grow!

Geodesy, the science of measuring the Earth's shape and positions on it, allows the measurement of plate motion directly using GPS, the Global Positioning System. This network of satellites is more stable than the Earth's surface, so when a whole continent moves somewhere at a few centimeters per year, GPS can tell.


Without access to the Plate Motion Sim, I cannot provide you with the specific measurements to fill out the data table. However, I can provide guidance on how to complete the task based on the instructions provided.

To measure how far plates move from each other over time, you will need to add a GPS marker to each plate as close as possible to each other and to the plate boundary. Then, you will need to set the boundary to Divergent and run the simulation.

During the simulation, you will need to press Pause approximately every 50 million years and record the time in the first column of the table. Next, observe the distance between the two pins by pressing on either pin and reading the distance to the other. Record that number in the Distance column.

To calculate the rate for each pair of distances and times, you will need to divide the distance by the time. Record those numbers in the Rate column. Finally, you can use the data to analyze the speed at which plates move and draw conclusions about plate tectonics.

The graph shown repressnts the growthin cell number over time which lline would be used to represent cancer

Answers

Answer:

it would be the fastest increasing one as it grows very rapidly

Explain which cells,tissues,or organs should be modified to lead to successful photosynthesis in animals or humans discuss how these compare to a plants leaves

Answers

cell are basic unit of life

To successfully achieve photosynthesis in animals or humans, modifications must be made to their cells, tissues, or organs involved in energy production and metabolic processes. One approach that has been proposed involves genetically modifying chloroplasts (organelles responsible for photosynthesis in plants) to enable them to function in animal or human cells.

What is the significance of chloroplast?

Chloroplasts are found in the leaves of plants and are responsible for converting light energy into chemical energy via photosynthesis. However, they are also found in other plant tissues, such as stems and roots, which play a role in energy production and storage.

What are muscle cells responsible for?

Muscle cells are responsible for movement and require significant energy to function. If modified to include chloroplasts, muscle cells could produce energy via photosynthesis, reducing reliance on other energy sources such as glucose.

To learn more about glucose, visit here:

https://brainly.com/question/30548064

#SPJ1

The repolarization of the atria is not indicated on an electrocardiogram because the repolarization is hidden by the T wave of the ventricles.

True

False

Answers

It is accurate to say that the repolarization of the atria is not visible on an ECG because the T wave of the ventricles obscures it.

How come atrial repolarization is obscured?

The wave of atrial repolarization is of little amplitude, undetectable. A typical P wave has a maximum height of 2.5 mm (two and a half 1-mm divisions) and a maximum width of 120 ms (three 1-mm divisions) in any lead.

Where in the ECG is atrial repolarization concealed?

Abbreviations. The electrocardiographic (ECG) deflection brought on by atrial depolarization is minimal in both amplitude and area when compared to the QRS complex. The subsequent QRS complex frequently obscures atrial repolarization.

To know more about ventricles visit:-

https://brainly.com/question/29564818

#SPJ1

I need help, please



1. Identify the muscles involved in a bicep curl. Briefly note their role when they contract: who are the candidates for prime mover and who is a synergist (to who). Note any antagonists (to Who).
2. During an overambitious workout, Vanessa pulls some muscles by forcing her knee into extension when her hip is already fully flexed. a) What muscle group does she pull? b) What muscles make up that group? c) What group is antagonistic to this group?
3. a) Identify the hip flexor, deep in the pelvis, that is a composite of two muscles. b) What muscle is antagonistic to the hip flexor?
4. Identify the muscles that allow you to draw your legs to the midline of your body, as when standing at attention.
5. What is the wrist flexor that follows the radius?
6. What is the name of the muscles of the lateral leg that plantar flex and evert the foot?

Answers

1. In a bicep curl, the main muscles involved are the biceps brachii (prime mover) and the brachioradialis and brachialis (synergists). The triceps brachii act as the antagonist muscle to the biceps brachii.
2. a) Vanessa most likely pulled her hamstring muscle group. b) The hamstring muscle group consists of the semitendinosus, semimembranosus, and biceps femoris. c) The quadriceps muscle group is antagonistic to the hamstring group.
3. a) The hip flexor deep in the pelvis that is a composite of two muscles is the iliopsoas, which consists of the psoas major and iliacus muscles. b) The gluteus maximus muscle is antagonistic to the hip flexor.
4. The muscles that allow you to draw your legs to the midline of your body are known as adductors. This muscle group includes the adductor longus, adductor brevis, adductor magnus, and gracilis muscles.
5. The wrist flexor that follows the radius is the flexor carpi radialis muscle.
6. The muscles of the lateral leg that plantar flex and evert the foot are the fibularis (peroneus) muscles, which include the fibularis longus and fibularis brevis muscles

The muscles involved in a bicep curl are the biceps brachii, brachialis, and brachioradialis. The biceps brachii acts as the prime mover, contracting to lift the weight and flex the elbow joint.

What is the role of brachialis and brachioradialis?

The brachialis and brachioradialis act as synergists, assisting the biceps in flexing the elbow joint. The triceps brachii acts as an antagonist to the biceps, working to extend the elbow joint and resisting the flexion created by the biceps.

a) Vanessa pulls her hamstring muscles. b) The hamstring muscle group is made up of three muscles: the biceps femoris, semitendinosus, and semimembranosus. c) The quadriceps muscle group is antagonistic to the hamstring group, working to extend the knee joint and resisting the flexion created by the hamstrings.

a) The hip flexor deep in the pelvis that is a composite of two muscles is the iliopsoas. It is made up of the iliacus and psoas major muscles. b) The gluteus maximus muscle is antagonistic to the iliopsoas, working to extend the hip joint and resisting the flexion created by the iliopsoas.

             

The muscles that allow you to draw your legs to the midline of your body are the adductor muscles. These include the adductor longus, adductor brevis, adductor magnus, gracilis, and pectineus muscles.

The wrist flexor that follows the radius is the flexor carpi radialis muscle.

Thus, The muscles of the lateral leg that plantar flex and evert the foot are the peroneus longus and peroneus brevis muscles.

Learn more about hip flexors at :

https://brainly.com/question/30262611

#SPJ2

How could you investigate the lowest possible effective dose to use against a particular strain of bacteria

Answers

Stimulations were ran to examine the effects of changes in dosage distribution and antibiotic exposure frequency on community resistance patterns.

What are Antibiotics ?

Antibiotics are antimicrobial substances that are active against microorganisms. Antibiotic drugs are widely utilized in the treatment and prevention of bacterial infections since they are the most significant form of antibacterial agent. They can either kill or hinder bacterial growth. A small proportion of antibiotics have antiprotozoal action. Antibiotics are ineffective against viruses such as the common cold or influenza; instead of antibiotics, medications that decrease virus growth are referred to as antiviral drugs or antivirals. They are also ineffective against fungi; antifungal medicines are those that hinder the growth of fungus.

What is Antibiotic resistance ?

Antibiotics are antibiotics that are used to prevent and treat bacterial infections. Antibiotic resistance arises when bacteria adapt to the usage of these medications. Antibiotic resistance develops in bacteria rather than people or animals. These bacteria can infect humans and animals, and their infections are more difficult to treat than infections caused by non-resistant bacteria.

Antibiotic resistance raises medical expenses, lengthens hospital stays, and increases mortality.

The world urgently needs to modify the way antibiotics are prescribed and used. Even if new medications are found, antibiotic resistance will remain a big threat unless behavior changes. Changes in behavior must also include efforts to minimize the spread of illnesses such as immunization, hand washing, safer sex, and excellent food hygiene.

To know more about Antibiotic , visit ;

brainly.com/question/10868637

#SPJ1

how many stomach compartments are in a ruminant animal?

Answers

Answer:

4

Explanation:

there are four stomach compartments in a ruminant animal.

This model of the carbon cycle shows the continuous movement of carbon atoms between the biosphere, atmosphere, hydrosphere, and geosphere. Some processes store carbon while others release it. Deforestation, the clearing or thinning of forests by humans, has. significant impact on the carbon cycle. What is a likely consequence of deforestation?
Responses

Answers

Deforestation's main effects include the extinction of priceless wildlife and rare plant and animal species as a result of habitat loss, soil erosion, exacerbated floods and drought, pollution, and elevated levels of carbon dioxide.

What are the Class 9 effects of deforestation?

The atmosphere and climate have been severely altered by deforestation. Moreover, it has caused soil erosion and desertification, increased greenhouse gas levels, and posed a threat to biodiversity and animal habitats.

What is Class 8 long answer for deforestation?

Deforestation is the intentional clearing of wooded land. Throughout history and into the present, forests have been removed to make place for agriculture and animal grazing as well as to obtain wood for use in manufacturing, construction, and heating.

To know more about Deforestation's visit:-

https://brainly.com/question/17178423

#SPJ1

Please help
1. Describe specific anatomical characteristics for typical cervical, thoracic, and lumbar vertebrae

2. Describe the structure of an osteon.

Answers

1.) Specific anatomical characteristics of typical cervical, thoracic, and lumbar vertebrae:

- Cervical vertebrae: There are seven cervical vertebrae in the human spine, located in the neck region. They are smaller and more delicate than the thoracic and lumbar vertebrae. Cervical vertebrae have a bifid (split) spinous process and transverse foramina, which allow passage of the vertebral arteries and veins that supply blood to the brain. They also have small, oval-shaped vertebral bodies and relatively large vertebral arches.

- Thoracic vertebrae: There are twelve thoracic vertebrae in the human spine, located in the upper back region. They are larger and more robust than the cervical vertebrae. Thoracic vertebrae have long, downward-pointing spinous processes and costal facets for articulation with the ribs. They also have heart-shaped vertebral bodies that are larger than those of the cervical vertebrae, but smaller than those of the lumbar vertebrae.

- Lumbar vertebrae: There are five lumbar vertebrae in the human spine, located in the lower back region. They are the largest and strongest of the vertebrae. Lumbar vertebrae have short, thick spinous processes and large, kidney-shaped vertebral bodies. They also have broad, flat transverse processes and no costal facets, as they do not articulate with the ribs.

2.) Structure of an osteon:

An osteon (also called a Haversian system) is a cylindrical unit of compact bone tissue that forms the basic structural and functional unit of bone. It consists of concentric layers of bone tissue called lamellae, which are arranged around a central canal called the Haversian canal. The Haversian canal contains blood vessels and nerves that supply nutrients and oxygen to the bone cells (osteocytes) and remove waste products. The osteocytes are located in small spaces called lacunae, which are connected by tiny channels called canaliculi. The canaliculi allow the osteocytes to exchange nutrients and waste products with each other and with the blood vessels in the Haversian canal. The osteons are interconnected by perforating canals called Volkmann's canals, which allow blood vessels and nerves to penetrate the bone tissue and connect adjacent osteons. Together, the osteons form a strong and flexible matrix that gives bone its characteristic strength and resilience.

Stefan says that asexual reproduction is always better for a species than
sexual reproduction. Is he correct? Why or why not?

Answers

Answer:

Stefan's statement that asexual reproduction is always better for a species than sexual reproduction is not entirely correct. Both asexual and sexual reproduction have advantages and disadvantages, and the choice between them depends on various factors.

Asexual reproduction can produce offspring quickly, and a single individual can produce many offspring. Asexual reproduction also allows for the reproduction of organisms in stable environments where there is little genetic diversity needed. However, asexual reproduction does not provide genetic diversity in the offspring, which can lead to a lack of adaptation to changing environments and increased vulnerability to diseases and parasites.

Sexual reproduction, on the other hand, produces offspring that have greater genetic diversity, which can increase the adaptability of a species to changing environments. Sexual reproduction also allows for the elimination of harmful mutations and the recombination of beneficial genes, which can increase the fitness of offspring. However, sexual reproduction requires two individuals and is slower than asexual reproduction.

Therefore, the choice between asexual and sexual reproduction depends on the environment, the species, and the circumstances. In some cases, asexual reproduction may be advantageous, while in others, sexual reproduction may be more beneficial for the survival and success of a species.

Explanation:

Solution

Sexual mode of reproduction is considered to be better than the asexual mode of reproduction. This is because, in asexual reproduction, the only single parent gives rise to another offspring which is exactly similar to the parent as it passes its genetic material to the offspring. So, there are no chances of inducing variations in progeny and so their environmental adaptability remains low. In the sexual mode of reproduction, there are fusion gametes of two parents, male and female. As a result, the offspring has the genetic material of both, and so there is greater variation among the offsprings. They are better suitable and adaptive to their environment due to variations introduced in them during meiosis cell division and crossing over. So they are more suited to the environment they live in. So, organisms born through the sexual mode of reproduction are the better and sexual mode of reproduction is better than the asexual mode.

Dogs pant because
A) Evaporation causes cooling
B) Evaporation gets rid of excess water in the body
C) It is tired
D) Panting helps to raise body temperature

Answers

Answer:

(A)

Explanation:

they pant because they are cooling there

self down

8. What characteristics of a normal fault and a reverse fault can be used to easily tell them apart?
(9 points)

Answers

Answer:

Normal faults and reverse faults are two types of faults that occur in the Earth's crust. The main difference between these two faults is the direction of the movement of the hanging wall and the footwall. In a normal fault, the hanging wall moves downward relative to the footwall. In contrast, in a reverse fault, the hanging wall moves upward relative to the footwall. This difference in movement can be used to easily tell normal and reverse faults apart. Additionally, normal faults tend to occur in areas where the Earth's crust is being pulled apart, whereas reverse faults tend to occur in areas where the Earth's crust is being compressed or pushed together.

Explanation:

If the rocket pushes forward with a force of 675 N, what is the recoil force upon you, the shooter?

Answers

When the rocket is fired, the shooter will feel a backward force of 675 N.

What is force?

The interaction between two things that causes a change in motion for either one or both of the objects is referred to as exerting force. It is described as the pressure or pulling that one thing applies to another.

A force's magnitude, direction, and application point can all be used to define it.

How do you determine it?

With every action, there is an equal and opposite response, states Newton's third rule of motion.

When a rocket is fired, the action is the forward force the rocket exerts, and the reaction is the force the shooter feels as the rocket recoils.

The recoil force experienced by the shooter will be 675 N if the rocket pushes forward with a force of 675 N. This indicates that when the rocket is fired, the shooter will feel a backward force of 675 N.

To know more about force, visit:

https://brainly.com/question/13191643

#SPJ1

Mark has a friend name Chloe. How different are Marques and Chloee’s DNA

Answers

Answer:

completely different, 0.1% different.

Explanation:

in meiosis, the cell splits into 4 geneticly different daughter cells. The placement of the DNA is what makes them different.

I hope that

Other Questions
. Nitrogen-containing nutrients are recycled in ecosystems. Discuss the attitudes toward luxury categorized according to SRI Consulting Business Intelligence.Describe FIVE (5) of the obstacles to measuring social class in today's society. Find the area of the triangle Which of the following illustrates the "medicalization of deviance"?promiscuity being redefined as a "sexual addiction,theft being redefined as a "compulsive" disorder"drinking too much being redefined as "alcoholism"All of the above When listing items in order of importance:Group of answer choicesa.Bullets are always appropriateb. A numbered list should be used.c.The entire list should be in capitals. The U.S. population in 1910 was 92 million people. In 1990, the population was 280 million. Create both a linear and an exponential model of the population from 1910 to 1990, with projected data points at least every 20 years, starting with 1910 as year 0. Include both an equation and a graph in your answer.(Disregard what I wrote - My eraser didn't work well) write a story that ends with two heads are better than one The planetarium is remodeling and want to know the surface area of the building, including the skyview. Calculate the surface area and SHOW WORK. : The student clearly summarized the procedures for the lab in complete sentences. The identified test and outcome variables were accurate for the experiment. Test Independent Variable:HINT: What was different about your test groups? What did you choose to test?Outcome Variable/Dependent Variable:HINT: What were you measuring? What data did you record? which statement is not true about c3 and c4 plants? the first co2 fixation product in a c4 plant is oxaloacetate. c3 plants are more successful in mild climates than c4 plants. c4 plants contain chloroplasts only in part of their mesophyll cells. c3 plants fix co2 in the mesophyll cells. c3 plants make glucose in the bundle sheath cells. -. A 100.0 g Chunk of Aluminum with an Initial Temperature of 450.0 C is added to 100.0mL of Ethyl Alcohol with an Initial Temperature of 80.0 C (A) Calculate EquilibriumTemperature of the Mixture (B) Calculate the Heat Exchange of the SystemBA) 198 C B) 22770 J All answers ApproxD A) 110C B) 10000 J All answers ApproxA) 150 C B) 30000 J All answers ApproxA) 300 C B) 15000 J All answers Approx Who is regarded as the father of evolution by natural selection?* What is the quotient of (x + 3x + 5x + 3) = (x + 1)?O x + 4x +9O x + 2xOx+2x+3O x + 3x + 8 5. Jack has a 35-foot ladder leaning against the side of his house. If the bottom of the ladder is 21 feet away from his house, how many feet above the ground does the ladder touch the house? The number of nations participating in the Winter Games competition has been increasing over theyears, as shown in the table Use linear regression to find a linear function that can be used to predict thenumber of nations participating x years after 1988. Then predict those years in which more than 100nations will participate in the gamesWhat is the linear function that can be used for prediction?Year198819921995199820022006Number of Nations515861667174 as in the previous problems, consider the model problem (4.3) with a real constant a < 0. show that the solution of the trapezoidal method i Analyze and ExtendNow that you've observed some properties of reflection and absorption of light, answer some questions based ondata from Hector's investigations.Part AWere the predictions you made in the beginning of this activity correct? Write a paragraph highlighting two ways you can prepare for the ACT. Choose one that you will use and give the reason Determine the degree of the Maclaurin polynomial required for the error in the approximation of the function at the indicated value of x to be less than 0.001. (1/((0.2)+1)) (1/(x+1)) What is the best book that content all Disease and all things related with it