Arrange the levels of ecological organizations from smallest to largest

population
organism
community
ecosystem

Answers

Answer 1
Organism, Community, population, ecosystem

Related Questions

If you were on the ISS (International Space Station), how would you know that a solar eclipse took place on Earth?

Answers

Answer:you could ask your family or look it up you ar probably right next to a sadelite

so connection should be pretty good

Do all plants respond the same to all abiotic factors?

Answers

Answer:

Light intensity: limited light will limit photosynthesis. This will affect the distribution of plants, and therefore the distribution of animals that eat plants. ... Temperature: temperature is a limiting factor for photosynthesis - and low temperature therefore limits growth of plants.

In an earthworm is the dorsal blood vessel or the ventral blood vessel larger?

Answers

Answer:

Dorsal lol, its contracts and pumps blood to the aortic arches.

why does the temp of the air increase with the height of the stratosphere?

Answers

Answer:

The hot air rises and the cool air falls

Explanation:

Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil

Answers

Answer:

B)Magma

Explanation:

The process by which modern organisms have descended from ancient organisms

Answers

I believe it is called evolution and you can see this with a genetics tree

Answer:

evolution, or change over time

Explanation:

how does Pteromyzon differ from scolidon and labeo fishes?
who answer this question in 10 seconds I'll mark his or her ans. as "BRAINLIST ANSWER"
It's my promise but the answer must not be copied from internet​

Answers

Answer:

Due to no jaws, no paired fins and scales on the body.

Explanation:

Pteromyzon fish is different from scolidon and labeo fishes because Pteromyzon fish is not a true fish. The main reason for this is that Pteromyzon fish is agnathous means having no jaws and it doesn't have paired fins and scales on their body while all these features are present on the body of  scolidon and labeo fishes so we can conclude from this discussion that Pteromyzon fish is different from scolidon and labeo fishes.

Question 14 (2 points)
(06.03 MC)
Which of the following correctly identifies a lymphatic organ and describes how it
can fight cancer? (2 points)
1) Lymph vessel; removes fluid from tissues
2) Lymph trunk; returns lymph to the blood
3) Spleen; replaces damaged red blood cells
4) Thymus; exposes lymphocytes to antigens

Answers

All of the statements correctly identify a lymphatic organ. In vertebrates, the lymphatic organs, also known as the lymphoid system, are an organ system that is a part of the immune system and works in conjunction with the circulatory system.

The Lymphatic OrgansLymphatic vessels, which are found all over your body and transport lymph away from tissues, are a network of capillaries (microvessels) and a huge network of tubes.By emptying into the corresponding subclavian veins, the lymph ducts, which are formed by the lymph trunks, restore lymph to circulation.Red blood cells that are outdated or damaged are eliminated by the spleen, which also removes cellular waste from circulation.Training specific white blood cells known as T-lymphocytes or T-cells is the thymus gland's main job.

Hence, all of the statements correctly identify a lymphatic organ.

How lymphatic system fights Cancer?Regional lymph nodes, which are predictive of distant organ metastases and poor survival, are accessible to tumor cells via lymphatic arteries.As the lymph fluid moves through the lymph nodes, it is filtered. B cells and T cells, two types of white blood cells, assault any viruses or bacteria they discover in the lymph.

To learn more about the Lymphatic System refer to:

https://brainly.com/question/13676212

#SPJ1

Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?​

Answers

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?

Answers

The name of the gas is t

Which plant cell structures capture sunlight to produce sugars? a. vacuoles b. ribosomes c. mitochondria d. chloroplasts​

Answers

Your answer is D. It uses light energy of the sun into sugars that can be used by cells. It is like a solar panel that changes sunlight energy into electrical energy.

Why are bananas curved?

Answers

Answer:

It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.

Explanation:

g.o.o.g.l.e lma o

Answer

It's because of the sun!

Explanation:

Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.

Why are viruses considered nonliving but bacteria are considered living? Give two reasons.
Not a long life story but a simple two reasons.

Answers

Answer:

1-Viruses also lack the properties of living things: They have no energy metabolism, they do not grow, they produce no waste products, and they do not respond to stimuli.

2-They also don't reproduce independently but must replicate by invading living cells.

Viruses are considered non living since they are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy.

Fill in the blank: ______ is the process that splits rock when water seeps into cracks, then freezes and expands.
YES I WILL HAVE A LOT OF FILL IN THE BLANK GET READY

Answers

Answer:

Freeze-thaw

Explanation:

Answer:

frost wedging

Explanation:

Scientific investigations often lead to the formulation of new scientific questions. The observations Charles Darwin's work after he returned home from his voyage and studying the selective breeding of pigeons prompted him to ask which question?

A) Do living things change over time, and if so, how?
B) Are the Galapagos finches and those on the mainland the same species?
C) Are pigeons related to the Galapagos finches?
D) Can selection in nature also lead to a new species over time?

Answers

Answer: D. Can selection in nature also lead to a new species over time?

Explanation:

Answer:

Can selection in nature also lead to a new species over time?

Explanation:

Correct on edge 2021 hope this helps :)

When do you think the rays of the sun encounter particles

Answers

All of the energy from the Sun that reaches the Earth arrives as solar radiation, part of a large collection of energy called the electromagnetic radiation spectrum. Solar radiation includes visible light, ultraviolet light, infrared, radio waves, X-rays, and gamma rays.

What are the like terms in the expression: 2a + 3b+ 40 - 5a + 8 - 4
O 2,3,4,-5
O 2a, 3b, 4c
O-5a, 8
O2a, -5a, 8, -4


i need help plzz

Answers

Answer: 2,3,4,-5

Explanation:

it seems that 40 is supposed to be 4c.

the terms can be grouped in several ways

2a, -5a                   Contain factor ‘a’

8, -4.                Simple integers/constants

2a, 4c,  8, -4.          Even numbers

2a, 3b, 4c,  -5a       Contain a factor      

Can’t group on + or - because values of a,b,c are unknown

From the available choices, only 2,3,4,-5 matches a logical group.

What is Pedigree?? Can someone help me i need this answer plzzzzzz

Answers

Answer:

A pedigree is like a lineage or a recorded ancestry. For example, if a dog has recorded breeding papers it would show you it's pedigree. I hope that helped! :)

Combined sewage overflow has been linked to eutrophication in ecosystems within NYC, including Jamaica Bay and Coney Island Creek. Based on your understanding of eutrophication, why might combined sewage overflow be causing an overgrowth of harmful algae in NYC? Explain your answer in YOUR OWN WORDS please.

(This is 7th grade science).

Answers

like your name

Explanation:

Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.​

Answers

Answer:

a. The ability to cure genetic diseases by replacing defective genes

Explanation:

What causes antibiotic resistance?
- Only using antibiotics when you are also doing radiation therapy
- Only using antibiotics when you are also doing chemotherapy
- Any use of antibiotics causes resistance
- We do not know

Answers

Answer:

Antibiotic resistance occurs when bacteria change in response to the use of these medicines. Bacteria, not humans or animals, become antibiotic-resistant. These bacteria may infect humans and animals, and the infections they cause are harder to treat than those caused by non-resistant bacteria.

your welcome ;)

Explanation:

What larger part of the body do cells make up?​

Answers

Each cell has a size and shape that is suited to its job. Cells that do the same job combine together to form body tissue, such as muscle, skin, or bone tissue.

Answer:

i pretty sure it ovum :)

Explanation:

The chemical equation for cellular respiration is:

glucose + oxygen ----> your mama

carbon dioxide + water
sunlight --->glucose + oxygen

oxygen + carbon dioxide glucose + water

glucose + oxygen --->carbon dioxide + water + ATP (energy)

Answers

Answer: The last one

Explanation:

Glucose+oxygen----> Carbon dioxide+ water+ ATP(energy)

Which of these are an important part of a scientific process? ​

Answers

Answer:

Is it multiple choice?? If it is, then show us the options

Explanation:

What is the main function of the smooth and rough Endoplasmic Reticulum in a cell?

Answers

Answer:

Smooth endoplasmic reticulum provides vesicles for the Golgi apparatus whereas rough endoplasmic reticulum provides biochemical for the Golgi apparatus. Both smooth and rough endoplasmic reticulum helps in the synthesis and storage of proteins.

Hope this helped!

Which plant propagation process insures some genetic diversity?

Answers

Answer:

Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.

Explanation:        

Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.  

Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.

Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.

I have a question.... my teacher today in biology said " you think you are moving your hand by yourself, but it's actually your brain sending commands to your muscles so they can move." So I wondered.. is my brain sending commands so I can think, or am I thinking whenever I have a desire to? (Not a trick question; My friend thinks this is a trick question lol).

Answers

Answer:

you are think of a command and your brain respond to you desire

Explanation:

70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.

Answers

Answer:

can I write an essay

Explanation:

On April 20, 1902, Marie and Curie with success isolate radioactive  metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic  radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.

Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.

we need a picture ..

Describe some of the reasons for exploring the mid-Cayman ridge.

Answers

Answer:

Life on Earth goes back almost 4.1 billion years, but photosynthesis as characterized by cyanobacteria only appeared around 3.5 billion years ago (Ga). Since life on Earth predates photosynthesis, the exploration of this deep-water environment that lacks any source of light could provide information on what those life forms looked like.

Explanation:

This was the answer on edge

The major reason for exploring the mid-Cayman ridge is to provide

information on what those life forms looked like.

What is Photosynthesis?

This is the process in which plants manufacture their food in the presence

of sunlight and other compounds.

The mid-Cayman ridge which is present in a deep water environment has

lacks any source of light has some life-forms present. The exploration was

to find out the type of life forms present and how they appear.

Read more about Mid-cayman ridge here https://brainly.com/question/2747950

In the light independent reaction _____, ______, and ______ combine to make ______ and ______

Answers

Answer/Explanation:

In the light independent reaction carbon dioxide, ATP, and NADPH combine to make glucose and oxygen.

Other Questions
which of the following is a pair of complementary angles Yellow Cab Taxi charges a $1.75 flat rate in addition to $0.75 per mile. Katie has no more than $10 to spend on a ride. How many miles can Katie travel without exceeding her limit? 1) A recipe for a fruit drink calls for 2 cups of fruit juice for every 5 cups of water. Look at each drink mix. Does each drink mixfollow the recipe?YesNoA 4 cups of fruit juice and 10 cups of waterYesNoB 0.5 cup of fruit juice and 1 cup of waterYesNo1 cup of fruit juice and 2.5 cups of waterYesNoD7 cups of fruit juice and 17 cups of water 1. What is the downward fores that acts on an airplane in flight?B. dragC. thrustD. gravity A cylinder has a volume of 198 cm3, and its base has an area of 22 cm2. What is the height of the cylinder? V= rh 2008 crisis question. Will is w years old.Ben is 3 years older.1. Write an expression, in terms of w, for Ben's age.Jan is twice as old as Ben.2. Write an expression, in terms of w, for Jan's age.If you add together the ages of Will, Ben and Jan the total comes to 41 years.3. Form an equation and solve it to work out how old Will, Ben, and Jan are. Which statement best describes the "Scramble for Africa"? Type the correct answer in the box. Spell the word correctly. Senator proposed policies to improve the national economy known as the American System. all 3 of these examples (Volt, Newton, Tesla) are units that come from other metric units true or false? Part B Select two stanzas from Passage 2 that support your response to Part A. A. "At winter's close, my heart was cold, Frozen like the great outdoor. Boredom kept out all the warmth; I found no fun in school or chores."B. Mrs. Grady lived next door, Her garden withering away. She could not do the work alone. Her hands were shaking more each day." C. "And so I worked-by her side- Churning up the rich, black earth, Raking, weeding, composting Preparing ground for springtime birth." VD. "In furrows etched into the ground, Sprinkled seeds sunk into place; Veggie plants soon found their homes, Growing each in their own space."E. "To make new friends, try new things; Put yourself out there, join a team, Improve your mind, stretch your wings, And don't you dare forget to dream." Identify one effect of the creation of Gutenbergs press.a. literacy rates increasedb. scientific discoveries were less likely to be widely knownc. interest in the Americas declinedd. the middle ages what happens to the chemical bonds during chemical reactions 2[tex]^{2}[/tex] + 5 + 50 2(5) What is an appositive phrase and what is its purpose?Hi , I really need to this so I can take my sister out for ice cream - so if anybody can solve this asap it'll be appreciated ^^ If the area of a circle is 25pi (n), what is the radius of the circle 7.) DURING THE FIRST ERA, THE __________ ORGANISMS EVER ON EARTH WEREERA, THE FIRST LIVING Find whole numbers a,b,c so that Solve for z.Z/4 - 11= -9Z= Please help as fast you can