A phenotype ratio of 9:3:3:1 in the offspring of a mating of two organisms heterozygous
for two traits is expected when:
A. the genes reside on the same chromosome
B. each gene contains two mutations
C. the gene pairs assort independently during meiosis
D. only recessive traits are scored
E. none of the above

Answers

Answer 1

C. the gene pairs assort independently during meiosis.


Related Questions

So basically how do i ask my best friend out?

Answers

Answer:

Explain

well just do it i belive in you dont try to act all diffrent or cool that makes people not like u just be yourself

What changes occur in the atmosphere as you go higher?.

Answers

Answer:

Air pressure drops, and temperatures get colder.

Explanation:

Hope this helps!!

What that determines if a cell is eukaryotic. *

Answers

To determine whether a cell is a eukaryotic or
prokaryotic cell, one can observe certain features.
If the cell in the question possesses a well-defined
or definite nucleus and have membrane-bound
organelles such as mitochondria, chloroplasts,
Golgi apparatus, endoplasmic reticulum, the cell is
eukaryotic. If the cell has nucleoid or indefinite
nucleus and without membrane-bound cell
organelles, the cell is prokaryotic. If ribosomes in
a cell are the 80S (S=Svedberg units) type, the cell
is eukaryotic and if ribosomes are 70S type then it
is prokaryotic.
there’s not any answer choices, but eukaryotic cells possess a clearly defined nucleus. they also have more organelles

Evaluate the role of media in addressing substance abuse with special reference to the following . 1television 2.social media platforms​

Answers

Social media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

What is social media?

Social media are online platforms that allows the user to create, write or display content and share with viewers and it also helps to access information and participate in many social networking.

Socal media campaigns have been done on television programs and other social media platforms to prevent the illicit use of drug by young and old people. This is because most young people visit the online platforms more and awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Therefore, media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.

Learn more on social media here,

https://brainly.com/question/3653791

Name the five carbon sugar in a DNA neucleotide

Answers

deoxyribose is the 5carbon sugar found in DNA nucleotides

VIDA chart for biology

Answers

Answer:

Yes you are right I didn't get the question too.

Which object measures atmospheric pressure?
a ballast tank
a barometer
a thermometer

Answers

Answer:

A barometer

Explanation:

It is commonly used to measure atmospheric pressure

Why is over farming a threat to the health of humans?

A.
It decreases the use of fertilizer.

B.
It increases the production of food.

C.
It adds too many new nutrients to the soil.

D.
It removes too many nutrients from the soil.

Answers

Answer:

it removes too many nutrients from the soil.

Explanation:

Explanation:

it can increas the health risk

Which of these is a benefit of fish farming?
A. It poses a risk of disease for wild stocks.
B. It depletes fish populations.
C. It eases the demand on commercial fisheries.
D. It pollutes natural bodies of water.

Answers

Answer:

C

Explanation:

It's pretty simple really, just find the Benefit. Pollution is definitely a harmful effect, disease is also not a benefit, and depletion of fish population is bad, so easing demand on commercial fisheries is the answer

What are the impacts of genomic era on microbial phylogeny systematics​

Answers

provide a platform for current research on archaea, bacteria, microbial eukaryotes and viruses.

Natural gas drilling locations are determined by
a random drilling
b. seismic surveys
C. natural gas dogs
d satellite surveys

Answers

Answer:

The answer is b. seismic surveys.

Answer:

B - SEISMIC SURVEYS

Explanation:

What is salinity and how does it change?.

Answers

A balance between water withdrawn by evaporation and freshwater added by rivers and rain controls salinity. The Mediterranean Sea in Europe has a salinity of 38 parts per million or more. It's nearly cut off from the main ocean, and there's more evaporation than rain or additional freshwater from rivers.

Salinity is controlled by a balance between water removed by evaporation and freshwater added by rivers and rain. changes in evaporation and rainfall, ocean currents, melting ice, and freshwater influx from rivers or streams can influence patterns of sea surface salinity, making some regions saltier and other regions fresher over time.

Which is NOT an example of leaves humans commonly eat?

Spinach
Zucchini
Kale
Field greens

Answers

zucchini is an example of leaves that humans don’t commonly eat.

Zucchini is a squash not a leaf.

Answer:

zucchini

Explanation:

The Earth’s rotation is the only thing that impacts wind

Answers

Answer:

false

Explanation:

While the Earth's rotation does play a role, it is a somewhat indirect one. The primary factor that affects the formation of winds is differences in atmospheric pressure. As is true throughout nature, any fluid will try to move from a region of high pressure to a region of low pressure.

Answer:

False

Explanation:

This is false because the earth goes one way but the wind can go all kinds of ways

What is black soil best for?
O constructing buildings
O having a wildlife environment
O having a desert environment
O farming land

Answers

Answer:

I believe the answer is farming

Answer:

having a wildlife environment

Explanation:

I took the test and this was the correct answer so your welcome

Describe the different internal and external factors that affect human health.

Answers

Answer: Biology, psychology, emotions, spirit, energy, lifestyle, culture, economic and political influences, social interactions in family, work, living area and the possibilities to expresses oneself and live full life with a sense of well-being have influence on people appearances.

Explanation:

Can someone PLease help me with these questions?!

Answers

Answer:

I can't read it. It is too small

Explanation:

It is too small for me to read

11
12
13
14
15
16
17
18
19
20
Air pollution affects everyone equally.
Please select the best answer from the choices provided
OT
OF

Answers

Answer:

16

Explanation:

Air pollution affects everyone equally is true statement.

What is Air pollution?

When pollutants are released into the atmosphere, they endanger both human health and the health of the entire planet. The World Health Organization (WHO) estimates that air pollution causes close to seven million deaths worldwide each year.

Currently, nine out of ten people breathe air that contains more contaminants than the WHO's recommended levels, with those in low- and middle-income nations suffering the most.

The 1970-established Clean Air Act gives the U.S. Environmental Protection Agency (EPA) the power to protect public health by controlling the emissions of certain dangerous air pollutants.

Therefore, Air pollution affects everyone equally is true statement.

To learn more about Air pollution, refer to the link:

https://brainly.com/question/18951513

#SPJ7

How have hominid skulls changed over time? What are some of the reasons for those
changes?

Answers

Answer:

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Explanation:

Give brainlist me please

Skull and face changes define modern humans - Harvard Gazette

The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.

Which compounds are not soluble in water?

Answers

answer :

All salts of : carbonate, CO3 2- phosphate , PO4 3- oxalate, C2O4 2- chromate, CrO4 2-sulfide, S 2- most metal hydroxides and oxides (OH-)

Exceptions :

Salts of NH4 +, and the alkali metal cations

Answer:

All salts of : carbonate - phosphate - oxalate, chromate,- most metal hydroxides and oxides

Explanation:

The graph shows the change in seabird mortality rates in New Zealand waters due to illegal, unreported, and unregulated fishing (IUU) and the implementation of bycatch remediation measures in 2004. What conclusion can be made about the impact of the remediation measures that were used?

Illegal and unregulated fishing practices continue to cause increases in bird bycatch numbers, in spite of the new measures.
Legal fishing practices have caused the new remediation measures to become more effective.
The measures virtually eliminated all of the bird bycatch.
The measures used showed very little impact on the overall seabirds caught in fishing lines.

Answers

According to the graph, the measurements practically eliminated all incidental captures, as shown in the third answer option.

What does the graph show?Illegal capture practices show a high performance between 1997 and 2003.Illegal capture practices show a low performance from 2004 and this performance tends to fall in the next years until it presents very low values.Legal capture practices maintain a balanced performance.

The decrease in the performance of illegal practices from 2004 onwards, shows how the remediation measures were efficient in reducing the activity of these practices and providing a better environmental well-being.

More info about graphics on the link:

https://brainly.com/question/14323743

Which type of rock would most likely be found near the landform shown in the picture? ​

Answers

Answer:

Igneous rock because it forms when hot molten rock (lava) crystallizes and solidifies .

Explanation:

Have a Nice day!!  :D

the autonomic nervous system controls
A. tying your shoes
B. Heart Rate
C. chewing a bite of food
D. using a fork

Answers

The answer will be :

B. Heart Rate

the answer is B heart rate

Which would have a bigger effect on an organism, an error during transcription or a missense mutation? Explain in one or two sentences. (

Answers

How does a missense mutation affect the function of a protein?

A missense mutation will change the amino acid sequence. This may alter the function of the protein, usually negatively, but sometimes positively. This later case may be favored by evolution, as the change is heritable.

Human Use of Land
Journal Activity Active
Prompt
How has human land use impacted the environment?
Read More >>

Answers

Decreased water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

How human impacted the environment?

Humans impact the environment in many ways such as overpopulation, pollution, burning fossil fuels, and deforestation. Human activities triggered climate change, soil erosion, poor air quality, and undrinkable water.

So we can conclude that reduction of water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.

Learn more about environment here: https://brainly.com/question/17413226

At each link of the food web, approximately_________
percent of the energy is passed on to the consumer and
approximately_________
percent of the energy is lost as
heat.

Answers

Approximately 10 percent of the energy is passed on to the consumer and approximately 90 percent of the energy is lost as heat.

What is a Food web?

This refers to an interconnecting diagram that shows the overall food relationships between organisms in a particular environment.

90 percent of energy is usually lost as heat thereby allowing for the transfer of only 10 percent of energy to the consumers.

Read more about Food web here https://brainly.com/question/2179

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Answers

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Answer:

C

Explanation:

Look at the tropical grassland ecosystem.

Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.
Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.

There are more zebra than the carrying capacity of the pictured ecosystem. This represents a

climax community
biological surplus
peak phenomenon
sigmoid phenomenon

Answers

Answer:

It is B Biological Surplus

Explanation:

Biological Surplus means that a species population has grown too big, above carrying capacity

What is the great pacific trash gyre?

Answers

Answer:

The Great Pacific garbage patch (also Pacific trash vortex) is a garbage patch, a gyre of marine debris particles, in the central North Pacific Ocean. It is located roughly from 135°W to 155°W and 35°N to 42°N.

At the molecular level, how do scientists know a new species has arisen?

Answers

Answer:

DNA sequencing has brought us the genetic species concept. In this model, species are defined by genetic isolation rather than reproductive isolation. Species may be more or less identical morphologically, but differences in DNA determine whether or not a population is a new species.

Explanation:

? :-)

Other Questions
Help if you understand thanks I really need help with the answers is respiration like burning?Explain your answer. what statement best describes the farms at the beginning of the great depression? A. Because of an increase in foreign-grown crops imported into the country, American crops decreased in value. B. Farmers during this time were unable to reach the production levels of earlier years because of a smaller available workforce. C. Farmers could not sell their crops because no one had money to buy them, so a barter system developed in rural areas. D. As the federal government acted to improve the economy, farming was surpassed by industry as the nation's top economic sector. Bought food. Fix the sentence When does sound become damaging to the human ear? If you could write a play about any topic, what would you write about and why? What recent movie or television show do you think would make a great stage production? Why What technical role do you think is the most challenging? What would you do if the lead performer of your show got pneumonia onopening night? How can actors help each other to succeed in their roles? If you were to go back to a certain era or to a different country to learn moreabout a certain type of theatre, when/where would you go and why? (For example: ancient Greek theatre, Japanese Noh theatre, the Renaissance, commedia dellarte in Italy, etc.) Whose job is easier: onstage performers or backstage crew? Why? What do you think will be the next big thing in the theatrical world? How could you present an extreme sport or extreme activity safely andcreatively onstage? (Such as downhill skiing, skydiving, rock climbing,surfing, bobsledding, etc.) What historical or literary character deserves to have a show written aboutthem? Que es el verbo? Que es el adjetivo? Why are streak plates used the test minerals? A. They show you the silicon content of the minerals B. They show you the colors of the impurities in the mineral C. They show you the true color of the minerals When did the constitution give all adult men the right to vote?. Which statement accurately compares timber and sunlight? timber and sunlight are nonrenewable resources. timber and sunlight are renewable resources. timber is a renewable resource, and sunlight is a nonrenewable resource. timber is a nonrenewable resource, and sunlight is a renewable resource. George wanted to measure the angle of a water slide at the lake. He used a sheet of folded paper that formed a 20 angle. He measured and found that three of the folded paper angles would fit in the angle made by the slide and the ground.Which of the following was the angle of the water slide? PLEASE HURRYSolve the inequality and express your answer in interval notation.x2 + 8x-7 Is my answer correct? Which action best illustrates jacob riis's response toward the conditionshe witnessed in new york's lower east side? *civil disobediencesettlement workmuckrakingboycotting As a team lead, Emilio has convened a group of five team members to solve an issue with the marketing campaign. This is an example of a(n) Which expression is the factorization of x2 10x 21? Which of the following things are symbolized by the color gold in the outsiders use the data in the table below to determine whether each plant is a short-day plant, a long-day plant, a day-neutral plant, or a plant that cannot be classified based on the data. Which section of a budget would the monthly electric bill best belong in?A. Housing and utilitiesB. Meals and entertainmentC. Groceries and suppliesD. Transportation Steam Workshop Downloader