A box at rest is in a state of equilibrium half way up on a ramp. The ramp has an incline of 42° . What is the force of static friction acting on the box if box has a gravitational force of 112.1 N ?

Answers

Answer 1

Answer:

Explanation:

The force of static friction acting on the box is the frictional force;

Frictional force Ff = Wsin theta (force acting along the ramp)

W is the gravitational force known as the weight

Ff = 112.1sin42°

Ff = 112.1(0.6691)

Ff = 75.00N

Hence he force of static friction acting on the box  if box has a gravitational force of 112.1 N id 75.00N

Answer 2

Answer:

75N i did test

Explanation:


Related Questions

Which of the following is true about particles of matter?

Answers

What are the possible answers

Answer:

Matter is a substance which has mass and takes up space by volume the properties of matter are,

States of matter (solid,liquid,gas)are inter convertable.

Force of attraction varies from one kind of matter to another.

States of matter can be varied by varying temperature and pressure.

Explanation:

Will mark brainiest!!!

1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *

2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *

3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *

4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *

5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *

All possible answers:
A. Earthquake
B. Tsunami
C. Magnitude
D. Sensor
E. Transform
F. Convergent
G. Divergent

Answers

Answer:

1. Tsunami

2.Divergent

3.Sensor

4.Convergent

5.Magnitude

Explanation:

An atom of the element chromium has an atomic number of 24 and a mass number of 52. How many electrons are in an uncharged atom of chromium?

0
24
28
52

Answers

Answer:

it's 24

Explanation:

I took the test and got 100 %

Answer:

24

Explanation:

A football player runs due South for 80 yards then cuts up the field due East for a distance of 45 yards before running into the end zone. What is the total displacement of the player?

Answers

Answer:

91.79 yards

Explanation:

Let the direction of the south be -y

Let the direction of the east be +x

The displacement is gotten by using the pythagoras theorem as shown;

Let d be the displacement;

d² = x² + y²

Given

x = 45 yards

y = -80 yards

Substitute the given values into the expression;

d² = x² + y²

d² = 45² + (-80)²

d² = 2025 + 6400

d² = 8425

d = √8425

d = 91.79 yards

Hence the total displacement of the player is 91.79 yards

Which type of energies make up the mechanical energy of a roller coaster moving along a track?

Answers

Answer:

gravitational potential energy and kinetic energy

Explanation:

A marble is given potential energy by being placed by a location w. When the marble is released it rolls down the track at which location dose the marble have maximum kinetic energy w x or y or z

Answers

Answer:

The answer is "Location Y"

Explanation:

Please find the complete question in the attachment.

As we show in the graph when the marble rolling with the full force it will stop on the y location because it is curved, and the marble can't move to another location, that's why the maximum kinetic energy of the marble is at the y location.

Rodney hits a 0.060 kg tennis ball straight up with a speed of 15 m/s from a height of 2.2 m above the ground. How fast is the ball going when it is 9.5 m above the ground?

Answers

Answer:

Explanation:

From the question we are told that

   The mass of the tennis ball is  [tex]m = 0.060 \ kg[/tex]

    The speed is  [tex]u = 15 \ m/s[/tex]

    The initial height of the ball is  [tex]h_o = 2.2 \ m[/tex]

     The height considered is  [tex]h = 9.5 \ m[/tex]

Generally the time taken to reach the considered height is mathematically evaluated from the equation of motion as follows

           [tex]h = h_o + ut - \frac{1}{2} gt^2[/tex]

=>         [tex]9.5 = 2.2 + 15t - \frac{1}{2} * 9.8 t^2[/tex]

=>         [tex]7.3 = 15t - 4.9t^2[/tex]

=>          [tex]4.9t^2 -15t + 7.3[/tex]

solving the above equation using quadratic formula

           [tex]t= 0.6070 \ s[/tex] and  [tex]t_1 = 2.454 \ s[/tex]

Generally from kinematic equation we have that

        [tex]v = u - gt[/tex]

=>     [tex]v= 15 - 9.8 * 0.6070[/tex]

=>      [tex]v= 9.0514 \ m/s[/tex]

Note if we had used the second values of time the velocity at 9.5 \ m would have been negative which is not correct given that at maximum height velocity is zero

What is meant by the components of a vector

Answers

when you break a vector into its parts, those parts are called its components. For example, in the vector (4, 1), the x-axis (horizontal) component is 4, and the y-axis (vertical) component is 1.

HELP ASAP FAST PLEASE I NEED HELP
Mechanical energy is defined as


Question 1 options:


the energy of motion and position, which is represented by the formula KE + PE = ME



potential energy



Energy of motion



Energy of machines and tools

Answers

Answer:

energy of motion is represented by formula KE+PE=ME

Answer:

formula:

KE+PE=ME

Explanation:

HOPE IT HELPS!

thank me later

What do we call the potential mechanical energy stored in an object when work is performed to change its shape?
A.) elastic energy
B.) sound energy
C.) kinetic energy

Answers

c) kinetic energy :)

What year was the RoboSapien toy robot released?
a) 2007
b) 2004
c) 2020
d) dunno

Answers

option b )2004........

Matt is driving his car around a curve that has a radius of 40 m. If his speed is 25 m/s as he negotiates the curve, find the centripetal acceleration for the curve.
A- 13.9 m/s2
B- 24.6 m/s2
C- 15.6 m/s2
D- 7.25 m/s2

Answers

Answer:

[tex]\huge\boxed{\sf a_{c} = 15.6\ m/s^2}[/tex]

Explanation:

Given Data:

Radius = r = 40 m

Speed = v = 25 m/s

Required:

Centripetal Acceleration = [tex]\sf a_{c}[/tex] = ?

Formula:

[tex]\sf a_{c} = \frac{v^2 }{r}[/tex]

Solution:

[tex]\sf a_{c} = \frac{v^2}{r} \\\\a_{c} = \frac{(25)^2}{40} \\\\a_{c} = \frac{625}{40} \\\\a_{c} = 15.6 m/s^2\\\\\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

As we know, the moon is a satellite of our earth, what is the
theoretical period of the moon? The average radius of the
moon's orbit is 3.84 108 m and the mass of the earth is 5.97 x
1024 kg (in hours, G = 6.67 x 10-9 N (m/kg) 3).

Answers

Answer:c

Explanation:c

This question involves the concepts of the time period, orbital radius, and gravitational constant.

The theoretical period of the moon is "658 hr".

The theoretical time period of the moon around the earth can be found using the following formula:

[tex]\frac{T^2}{R^3}=\frac{4\pi^2}{GM}[/tex]

where,

T = Time Period of Moon = ?

R = Orbital Radius = 3.84 x 10⁸ m

G = Gravitational Constant = 6.67 x 10⁻¹¹ N.m²/kg²

M = Mass of Earth = 5.97 x 10²⁴ kg

Therefore,

[tex]\frac{T^2}{(3.84\ x\ 10^8\ m)^3}=\frac{4\pi^2}{(6.67\ x\ 10^{-11}\ N.m^2/kg^2)(5.97\ x\ 10^{24}\ kg)}\\\\T^2=(9.91\ x\ 10^{-14}\ s^2/m^3)(56.62\ x\ 10^{24}\ m^3)\\\\T=\sqrt{561.34\ x\ 10^{10}\ s^2}[/tex]

T = 2.37 x 10⁶ s[tex](\frac{1\ h}{3600\ s})[/tex]

T = 658 hr

Learn more about the orbital time period here:

https://brainly.com/question/14494804?referrer=searchResults

The attached picture shows the derivation of the formula for orbital speed.

Typically, a bullet leaves a standard 45-caliber pistol (5.0-in. barrel) at a speed of 262 m/s. If it takes
1 ms to traverse the barrel, determine the average acceleration experienced by the 16.2-3 bullet withim
the gun and then compute the average force exerted on it.

Answers

U should use the website called acceleration calculator soup it helps a lot for physics

A car traveling at 50 m/s comes to a stop in 5 seconds. What is the
acceleration of this?

Answers

Answer:

10

Explanation:

10 is the answer because you divide 50  and 5 and your answer is 10.

Hope this helps:)

Pls mark brainlist

Answer:

a = -10m/s²

Explanation:

Givens:

Vf = 0m/s

Vi = 50m/s

t = 5s

Use the following kinematic equation:

Vf = Vi+at

Rearrange

a = (Vf-Vi)/t

a = -10m/s²

What makes the yardstick test a direct measurement of reaction time?
A.
The further the yardstick falls, the slower the reaction time.
B.
Yardsticks have numerical markings for length.
C.
Yardsticks are designed to measure reaction time.
D.
all of the above


Please select the best answer from the choices provided.

A
B
C
D

Answers

Answer:

A. the further the yardsticks falls, the slower the reaction time.

Answer:

The further the yardstick falls, the slower the reaction time.

Explanation:

its A

Which source of energy causes most of the water evaporation on Earth’s surface?
A.
wind
B.
solar
C.
gravity
D.
electrical

Answers

Answer:

I think it will be b. solar

Hope I can help.

Answer:

Explanation:

its b

PLEASE HELP ME IM TIMED

Answers

Yeah it’s the mantle

1. What is power, and what is its relationship to voltage and amperage? (4 points)

Answers

power is reffering to force

please help !!!!! I’ll give brainliest !

Answers

I think A but I dont really know

In its American colonies, Spain helped the Catholic Church meet its goal of
finding gold.
gaining territory.
converting people.
achieving glory.
This is from ed please help thank you

Answers

Answer: Converting people

Explanation: In Spanish colonies such as Florida, Spanish moved up into the other states to spread their christianity and were successful with doing so.

Converting people but I’m not sure

When velocity is graphed with respect to time, what does the area under
the line represent?

A) velocity

B) distance

C) acceleration

D) displacement


Answers

Answer:

the answer is D

Explanation:

Since the velocity of the object is the derivative of the position graph, the area under the line in the velocity vs. time graph is the displacement of the object.

The Answer

Is Displacement

what polarity must the red tip of the compass needle be since it points toward the south pole of the magnet?

Answers

Answer: positive

Explanation: because opposites attract and north=positive and south=negative the answer should be positive.

The polarity of the red tip of the compass needle must be at the north of the earth, since it points toward the south pole of the magnet.

What is meant by polarity of a magnet ?

Polarity of a magnet is defined as the orientation of both the north and south poles of the magnet in space.

Here,

We know that, the opposite poles attract.

The magnetic needle is arranged in a such a way that, the red tip of the magnetic compass needle is actually pointing towards the geographic north pole of the earth.

In order to point the compass needle towards the magnetic south pole, the south pole of the magnet must be located in the geographic north pole.

Hence,

The polarity of the red tip of the compass needle must be at the north of the earth, since it points toward the south pole of the magnet.

To learn more about polarity of magnet, click:

https://brainly.com/question/15329793

#SPJ2

A large ball of Play-Doh with a mass of 0.04kg is launched from a catapult with an initial
speed of 5m/s and an
initial height of 1.0m. What is the final speed of the ball right before it strikes the ground? Draw a picture!

Answers

Answer:

  ≈ 6.68 m/s

Explanation:

A suitable formula is ...

  vf^2 -vi^2 = 2ad

where vi and vf are the initial and final velocities, a is the acceleration, and d is the distance covered.

We note that if the initial launch direction is upward, the velocity of the ball when it comes back to its initial position is the same speed, but in the downward direction. Hence the problem is no different than if the ball were initially launched downward.

Then ...

  vf = √(2ad +vi^2) = √(2·9.8 m/s^2·1.0 m+(5 m/s)^2) = √44.6 m/s

  vf ≈ 6.68 m/s

The ball hits the ground with a speed of about 6.68 meters per second.

__

We assume the launch direction is either up or down.

Can someone help me in this please any one good in science.

Answers

Let's calculate the equivalent resistances on both circuits.

On Diagram A we have a series connection of the resistors. The equivalent resistance will be the sum of all resistances:

[tex]R_{eq}=1+1+1\\\\\boxed{R_{eq}=3\Omega}[/tex]

On diagram B we have a parallel connection of the resistors. The reciprocal of the equivalent resistance will be the sum of the reciprocals of all the resistances:

[tex]\frac{1}{R_{eq}} = \frac{1}{1} +\frac{1}{1} +\frac{1}{1} \\\frac{1}{R_{eq}}=3\\\\\boxed{R_{eq}=\frac{1}{3}}[/tex]

Therefore, the larger resistance occurs on diagram A.

For the current, recall

[tex]V=IR[/tex]

Where [tex]I[/tex] stands for current [tex]R[/tex] is the resistance and [tex]V[/tex] is the voltage. Rearranging the equation we have

[tex]I = \frac{V}{R}[/tex]

We can see that the larger the resistance, the smaller the current gets. So the larger current must happen in the diagram with smaller resistance. Therefore, the larger current occurs on diagram B.

Glad to help, wish you great studies ;)

Mark brainliest if you deem the answer worthy

2. (1) A piece of rubber is 50 cm long when a weight of
35 N hangs from it and is 85 cm long when a weight
of 70 N hangs from it. What is the spring constant
of this piece of rubber?​

Answers

Answer

By F = -kx {-ve just indicating the sign of the force}

=>35 = k x (85-50) x 10^-2

=>k = 100 N/m

Again by F = -kx

Calculate the average speed of a runner who runs for 500 meters in 40 second HELP!

Answers

Answer:

12.5

Explanation:

500 divided by 40 = 12.5

examples of uniform motion

Answers

Answer:

An airplane cruising at a level height and a steady speed.

A car going along a straight level road at steady speed.

A vibrating spring in a sewing machine.

A ship steaming on a straight course at steady speed.

A train going along the tracks at steady speed.

Explanation:

Hope this helps :)

Answer:

Examples of Uniform Motions.

The hr. ...

An airplane cruising at a level height and a steady speed.

A car going along a straight level road at steady speed.

A vibrating spring in a sewing machine.

A ship steaming on a straight course at steady speed.

A train going along the tracks at steady speed

I’ll give u BRAINLIEST PLEASE!! HURRY

Answers

Answer:

C

Explanation:

The temperature of a substance is 45 C. Convert this to Kelvin.

Answers

Answer:

it will be 318.5 Kelvin

Other Questions
10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs. plz help i need it :) will mark brainliest :D A work element in a manual assembly task consists of the following MTM-1 elements: (1) R16C, (2) G4A, (3) M10B5, (4) RL1, (5) R14B, (6) G1B, (7) M8C3, (8) P1NSE, and (9) RL1. (a) Determine the normal times in TMUs for these motion elements. (b) What is the total time for this work element in sec Community health problems can be addressed through the provision of health education. Justify it Moritz rescued his friend from a dangerous ocean rip current by pulling his friend from the water. Which activity most likely prepared him for this?enrolling in a class about swimming safetytaking a CPR training classwatching online shows about being a lifeguardtalking with friends who are lifeguards 2000x5000000000000000000000000000 in having trouble can someone help me please