5. The sodium-potassium pump is an example of
i. simple diffusion.
j. passive transport.
facilitated diffusion.
k. none of the above

Answers

Answer 1

Answer:

its passive transport

Explanation:

The sodium-potassium pump sets the membrane potential of the neuron by keeping the concentrations of Na+ and K+ at constant disequilibrium.

Answer 2
K

The Sodium-Potassium Pump. Active transport is the energy-requiring process of pumping molecules and ions across membranes "uphill" - against a concentration gradient. ... In active transport, as carrier proteins are used to move materials against their concentration gradient, these proteins are known as pumps.

Related Questions

Wyatt has heart problems

Answers

???? what is you talking about

Answer:

If Wyatt has heart problems, Wyatt can eat healthy foods to try and decrease the problems, Wyatt can also make sure that his weight and blood pressure isn't to high. Wyatt can try to get seen at the hospital to make sure everything is fine.

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

trna is bring a ggu anticodon what amino acid do you infer it will be carrying?

Answers

Proline

This is the amino acid that corresponds to GGU

To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement

Answers

Answer:

paper bags jute bags , cotton bags might be used for the environment

A cactus with the genotype Kkww is crossed with a cactus with the genotype KKWw. Which of the following genotypes will be shared by 25% of the offspring?
A. KKWW
B. kkWw
C. KKww
D. KkWW

Answers

Answer: C

Explanation: Think of it this way, which ever has the most is what answer would be. So they come across 3 capitals with K its gonna be KK not kk.

Hope this helps

The genotype is defined as the genetic makeup of an organism, or the set of alleles. The cross between Kkww and KKWw will result in 25% of the progeny having genotype KKww.

The correct option is:

Option C. KKww

Find the attachment for the Punnett square, given below.

The cross between Kkww and KKWw will result in the gametes as:

Kkww - Kw, Kw, kw, kwKKWw - KW, Kw, Kw, kw

The progeny having genotype as KKww will be 4 or 25%.

Therefore, Option C is correct.

To know more about cross and Punnett square, refer to the following link:

https://brainly.com/question/14642557

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

it takes 25 min to cook 10 egg how long does it take to cook 20​

Answers

Answer:

it takes 50 min

Explanation:

20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.

Work for it:

10 x 2 = 20

10 eggs=10 min

25x2=50

Answer:

it takes 50 minutes to cook 20 eggs

Explanation:

ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50

hope this helps

Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem

Answers

I’m thinking D. But A also looks like it could be right


1. How does the human body respond to exercise?

Answers

Answer:

the heart pumps more blood and sends it to the muscles. to create more blood more oxygen is used and you start to breathe harder. if you work out hard then you might get some lactic acid build-up.

hope this helped!

Through which of the following
would a sound wave travel the fastest?
a. Water vapor in the air
b. Water in the glass
c. Surrounding air
d. The glass

Answers

Answer:

D. The glass.

Explanation:

Sound travels fastest through solids. This is because molecules in a solid medium are much closer together than those in a liquid or gas, allowing sound waves to travel more quickly through it.

Hope this helps :D

The correct answer is D. The Glass Explanation: since the atoms in solids are closer together they would transfer sound the best, because sound travels best through solids

if a sample known to be about 11,460 years old and has 400 carbon 14 Adams how many atoms are in the sample when organisms just died

Answers

Answer:

There are 1600 atoms when organism just died.

Explanation:

The statement is incorrect. The correct statement is:

If a sample known to be about 11,460 years old and has 400 carbon 14 atoms. How many atoms are in the sample when organisms just died?

The amount of atoms associated with radioactive isotopes decreases exponentially in time by means of the following formula:

[tex]n(t) = n_{o}\cdot e^{-\frac{t}{\tau} }[/tex] (1)

Where:

[tex]n_{o}[/tex] - Initial amount of atoms.

[tex]n(t)[/tex] - Current amount of atoms.

[tex]t[/tex] - Time, measured in years.

[tex]\tau[/tex] - Time constant, measured in years.

In addition, the time constant can be calculated in terms of the half-life of the radioactive isotope ([tex]t_{1/2}[/tex]), measured in years:

[tex]\tau = \frac{t_{1/2}}{\ln 2}[/tex] (2)

If we know that [tex]t_{1/2} = 5,730\,yr[/tex], [tex]t = 11,460\,yr[/tex] and [tex]n(11,460\,yr) = 400[/tex], then the initial amount of atoms is:

[tex]n_{o} = \frac{n(t)}{e^{-\frac{t}{\tau} }}[/tex]

[tex]\tau = \frac{5,730\,yr}{\ln 2}[/tex]

[tex]\tau \approx 8,266.643\,yr[/tex]

[tex]n_{o} = \frac{400}{e^{-\frac{11,460\,yr}{8,266.643\,yr} }}[/tex]

[tex]n_{o} \approx 1600[/tex]

There are 1600 atoms when organism just died.

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

Explain how autotrophs need both cellular respiration and photosynthesis

Answers

Answer:

They get energy from food. Autotrophs make their own food through the process of photosynthesis, in which light energy from the sun is changed to chemical energy that is stored in glucose. And as for cellular respiration, all organisms use it to break down glucose, release its energy, and make ATP.

Explanation:

_____________

structures in the cell

Answers

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

The recessive gene for blood typing s...
Type O
Type A
Type B
Type AB

Answers

Answer:

Image result for what is The recessive gene for blood typing

Because A is dominant, that means your mother could carry a hidden O. If she does then when she gets pregnant, each child has a 50% chance of getting her dominant A and a 50% chance of getting her hidden, recessive O. If the child gets the O from mom and an O from dad, he or she will have an O blood type.

Explanation:

Brainliest if right?

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

Gravitational force multiple choice

Answers

Answer:

Option B. The force would be quartered (factor of 1/4).

Explanation:

The gravitational force between two objects can be expressed with the equation:

By analyzing the equation, we can see that if we multiply both m1 and m2 by 1/2, the resulting new F would be lower by a factor of 1/4 (as 1/2 times 1/2 equals 1/4).

Thus the correct answer is option B.

A cell membrane is called _____________ because it allows only certain substances to enter and leave the cell *

a. exocytosis
b. endocytosis
c. semipermeable
d. diffusion

Answers

The answers is semi permeable hope this helps

Maribel brings her backpack to the lab. She is also given a set of lab materials. What is the safest way for Maribel to organize these items in a lab?

Answers

Answer:

The personal items should be off the table, and the lab materials should be placed neatly away from the edge of the table.

Explanation:

It is given that Maribel goes to the lab with her backpack and she is given the lab materials to be used inside the lab to perform her experiment.

Now Maribel in the lab before doing her experiment must keep the personal items like her backpack off the working table and the lab materials are should be kept away from the edge of the table otherwise it might fall accidentally and hurt her.

One needs to be very careful while in the laboratory. One should follow the safety procedures to remain safe and also ensure safety of others. Being unsafe and disorganize can hurt others and can cause harm to others. There are various equipment and chemical in the lab. Therefore one should be careful while working in the lab.

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

Which statement is true about gold and helium?
O A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
c. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

Explanation:

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?

Answers

Answer:

Abnormally high temperature

Explanation:

Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.

When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.

Osmosis is important to cells because _______ *

a. cells contain fluids that are mostly water
b. cells are filled with fluids that are mostly sugar
c. cells need to be kept cool
d. cells need food

Answers

the answer would be A
Other Questions
A family requires 20,000 KJ of fuel energy every day. If calorific vlaueof the fuel used by them is 15,000 kJ/kg, how much of this fuel will be required by this family to meet their energy needs for the month of April? Help In math pls this a slope problem What is the value of x? B 75 Enter your answer in the box. X= Develop an argument that evaluates how the Columbian Exchange affected peoples in Afro-Eurasia in this time period. There were 20 questions on an exam. You answered 40% of them incorrectly. How many did you answer incorrectly? A defenseless creature , common lit a six sided cube is rolled. find the probability of P (4) as a decimal What is the dance movement when some one stands in the front and someone stands behind them then the person behind them moves to the side then front next to them while dancing usually happens in group dances Need help. brainliy to the first person that answers is right telling why With the Nile River playing a major role in the lives of the Egyptians, building ______ was an important part of their technology. papershipspyramidscoffee mugs*Ten Points. ( I will give a brainliest )What must be changed, temperature or heat energy, during condensation? I choose the short story Hamadi by Naomi Shihab Nye, What was the Protagonist's (Susan's) main motivation/goal? APE X What is happening to particles of matter while a change of state is taking place?a. They are staying at the same speedb. They are multiplying in number c. They are slowing down d. They are speeding up How did big business dominate the gilded age? give two examples of asexual Productions The least count of stopwatch is 0.2s.The time of 20 oscillations of a pendulum was measured to be 25s.Find the percentage error in the measurement of time Write the sum, and then write an equivalent expression by collecting like terms and removing parentheses whenever possible.d. The opposite of - 10t and t - 10t 6. Andrea deposits $350 dollars in herchecking account on Tuesday. OnWednesday she withdraws $100. OnThursday she deposits $75. Which of thefollowing shows the change in Andrea'saccount from Tuesday to Thursday?Help what element has three valence electrons in the second energy level. (b) Why does 'candy' come after 'candour' in the dictionary entry?