1. what is an organelle?

2. give me an example of an organelle.

3. Which organelle is the "command center" of
the center?

Answers

Answer 1

Answer:

1. a subcellular structure that has a job to do within the cell

2. mitochondria

3. the nucleus


Related Questions

PLEASE HELP ME!!!


3) Describe a eukaryotic cell. Your description should include where you would expect to
find these types of cells.

4)Describe a prokaryotic cell. Your description should include where you would expect to
find these types of cells.

Answers

3)Eukaryotic cells have membrane-bound organelles. They have a nucleus. They are usually found in animals and plants. In all multicellular organisms and some unicellular(amoeba)

4)Prokaryotic cells don't have a nucleus. They don't contain membrane-bound organelles they only contain ribosomes.They are much smaller. Bacteria are prokaryotes.

Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another

Answers

answer: yes

exanation:

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

what is a cell membrane?

Answers

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.

Explanation:

Answer:

Short. The semipermeable membrane surrounding the cytoplasm of a cell.

Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

Describe how the circulatory system allows the endocrine system to do its job?​

Answers

Answer:

The circulatory system is the transport system for endocrine info. The endocrine chemicals and hormones must circulate through the body via blood vessels.

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

describe and explain how the rate of photosynthesis is affected by light intensity​

Answers

Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply. At very high light intensities, photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

5 tips to improve your critical thinking - Samantha Agoos

Watch the Video and make a summary

Ps: They don't let me paste the link lookup what it says above

Answers

Answer:

that one is hard because we did not see the vidoe

Explanation:

What structure is responsible for the suction created by the
starfish's tube feet?

Answers

I believe it’s A or the first answer. Hope this helps :)

Tay-Sachs disease is a rare inherited disorder that progressively destroys nerve cells
in the brain and spinal cord. The allele for having Tay-Sachs is recessive written as t
and the functional allele is written as T. If two heterozygous parents have four
children, how many of the offspring will most likely inherit and develop Tay-Sachs
disease?

Answers

Answer:

B and C

Explanation:

I just took the test and it was right

plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion

Answers

I believe C- photosynthesis but I could be wrong.

Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore

Answers

Answer:

Decomposer

Explanation:

Decomposers eat dead organsims carnivores rarely

Answer:

C. Decomposer

Explanation:

A.P.E.X

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

Which is an example of the use of plants in human societs?

Answers

Answer:

|

v

Explanation:

photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.

Human uses of plants include both practical uses, such as for food, clothing, and medicine, and symbolic uses, such as in art, mythology and literature.

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

What are two ways in which cells use the energy temporarily stored in ATP?

Answers

Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways

The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.

What is Active transport?

Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.

ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.

Learn more about ATP here:

https://brainly.com/question/14637256

#SPJ2

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

This stuff annoying!!!!!!!!!!!!!!!!!!!!

Answers

wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink  wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink

What three things regarding cell organelles are different between plant and animal cells?

Answers

Answer:

Plant cells have a cell wall, but animals cells do not. ...

Plant cells have chloroplasts, but animal cells do not. ...

Plant cells usually have one or more large vacuole(s), while animal cells have smaller vacuoles, if any are present

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water

Which of the following IS NOT a part of the cell theory? *
All organisms are made of one or more cells
All cells contain nuclei and membrane bound organelles
Cells arise from pre-existing cells
Cells are the basic units of structure and function

Answers

Answer:

all cells contain nuclei.

Explanation:

prokaryotes dont have a nuclei

I need help with number 3​

Answers

O2 (oxygen) is a covalent compound

centricles play specific roles during the division of​

Answers

Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them

Explanation:

Adhesion occurs when water is attracted to other polar substances. Which of the following is an example of adhesion in organisms?
a. Capillary action of liquid in plant stems b. Release of sweat to reduce body heat
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system​

Answers

Answer:

a. Capillary action of liquid in plant stems

C. Movement of ions to maintain homeostasis

d. Pumping of blood through the circulatory system​

Explanation:

Hope this helped!

In organisms, an important example of adhesion is the: a. Capillary action of liquid in plant stems.

What is Adhesion?

Adhesion can be described as the attraction that occurs between molecules as a result of molecular mechanism, which is also known as capillary action.

In plants, capillary action occurs when the molecules of water cling to the xylem cell walls. This is known as adhesion.

Therefore, an example of adhesion in organisms is: a. Capillary action of liquid in plant stems.

Learn more about adhesion on:

https://brainly.com/question/14457491

#SPJ2

can u answer that question

Answers

Answer:

The synthesis of new proteins

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815

What do RNAs do in the cell?

Group of answer choices

Answers

Answer:

A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.

Explanation:

None

someone pleaseee help me with this !!

Answers

lizards and snakes!
Other Questions
Please select the word from the list that best fits the definitiona Catholic organization that held trials for people accused of false beliefs. Need now I will mark Brainly Decorations for a seventh-grade dance take 1/6 of the student council's budget. entertainment takes 3/8 of the budget. what fraction of the budget do these expenses cover? What fraction is left for other activities? i need help!! Please ASAP why might the author have capitalized the word "DO" 2. Identify what unit of measurement is used to measure blood pressure. I need a mental health supporter/ body gaurd on brainly What are the coordinates of point A if triangle ABC is rotated 90 to produce the image triangle ABC?A.(-9,-4)B. (4,-9)C. (9,-4)D. (9,4) Question 1 Which inference can be drawn about Bilbo's character based on Chapters 9 and 10 of The Hobbit? He dislikes the dwarves. He wishes he could return home. He is still confused about the mission. He is blessed with good timing and luck. Question 2 Part B Which excerpts best support the answer in Part A? Select the two correct answers. "'What I say,' said Bilbo gasping. 'And please dont cook me, kind sirs! I am a good cook myself, and cook better than I cook, if you see what I mean. Ill cook beautifully for you, a perfectly beautiful breakfast for you, if only you wont have me for supper.' 'Poor little blighter,' said William. He had already had as much supper as he could hold; also he had had lots of beer. 'Poor little blighter! Let him go!' 'Not till he says what he means by lots and none at all,' said Bert. 'I dont want to have me throat cut in me sleep! Hold his toes in the fire, till he talks!' 'I wont have it,' said William. 'I caught him anyway.'" "The day grew lighter and warmer as they floated along. After a while, the river rounded a steep shoulder of land that came down upon their left Suddenly the cliff fell away. The shores sank. The trees ended. Then Bilbo saw a sight: The lands opened wide about him, filled with the waters of the river which broke up and wandered in a hundred winding courses." "'No time now! said the hobbit. You just follow me! We must all keep together and not risk getting separated. All of us must escape or none, and this is our last chance. If this is found out, goodness knows where the king will put you next with chains on your hands and feet too, I expect. Dont argue. Theres a good fellow.'" "'Half a moment!' cried Bilbo, who was still thinking uncomfortably about eating. Fortunately he had once heard something rather like this before, and getting his wits back he thought of the answer. 'Wind, wind of course,' he said, and he was so pleased that he made up one on the spot. 'Thisll puzzle the nasty little underground creature,' he thought: An eye in a blue face Saw an eye in a green face. 'That eye is like to this eye' Said the first eye, 'But in low place Not in high place.'" is a tomato a fruit or a vegitable Which item is essential to know before sketching a navigation menu flowchart? template specifics, such as horizontal or vertical menu layout whether or not the site will implement a search feature all of the pages in the site and the content each page will contain who will be using the site and the design theme selected for them 4.How did the British attempt to attract settlers to Florida?(1 point)by abolishing slaveryby giving out monetary incentivesby giving outland grantsby providing workers for farming Autumn eveningtheres joy alsoin loneliness.BusonWhat motif is used in the first line of the haiku?lighttimebirdsloneliness Read the excerpt from The Land, Part 2.In the late afternoon I did the same, but all the time I was on the stallion, I was aware that Mitchell was watching me. He had appeared on the edge of the woods and had just stood there watching Ghost Wind and me as we went round and round the meadow. Finally, on one of our turns past him, he said: "S'pose you thinkin' you a real somebody 'cause you can ride that stallion."Based on this excerpt, which is a reasonable prediction?Paul and Mitchell will have a conflict about Ghost Wind.Paul and Mitchell will come to an understanding about Ghost Wind.Paul will forbid Mitchell from every riding Ghost Wind.Mitchell will successfully ride Ghost Wind with Pauls help. a , i got it right on my edge test Please help me I will MARK BRAINLIEST PLEASE DON'T IGNORE One day, when the girl had become a woman, a man appeared. No one knows where this man came from. Perhaps he was sent from the Gods above. The girl was so filled with wonder to see this strange man, she lost her senses and fainted. The man yielded two very different arrows, and laid them across the body of the girl in opposite directions, then he disappeared.Which statement best describes the significance of the arrows? Suppose your production costs increased. In 1 or 2 sentences, describe the effect of this increase on the quantity of goods you supply. What caused more deaths than the war itself? Please help me! I'm struggling! Solve the system, enter ur answer as an ordered triple.